báo cáo hóa học: " Apolipoprotein E isoform-dependent dendritic recovery of hippocampal neurons following activation of innate immunity" pot

... response to western-type diet. Specifically, we found that apolipoprotein E3 knock -in mice fed western-type diet for 24 weeks became obese and developed hyperglycemia, hyperinsulinemia, hyperleptin- emia, ... the 24-week period of feeding mice with western-type diet, fasting plasma samples were taken every 6 weeks, and cholesterol, triglyceride and free fatty acid levels were...

Ngày tải lên: 17/03/2014, 17:20

... Authors Journal compilation ª 2007 FEBS Apolipoprotein E-derived antimicrobial peptide analogues with altered membrane affinity and increased potency and breadth of activity Bridie A. Kelly 1 , Stuart ... the contribution of individual residues, and show that sub- stitutions for aromatic residues increase potency and breadth of activity, giving rise...

Ngày tải lên: 30/03/2014, 03:20

... Access Research Three-dimensional growth as multicellular spheroid activates the proangiogenic phenotype of colorectal carcinoma cells via LFA-1-dependent VEGF: implications on hepatic micrometastasis María ... hour of incubation of monolayer- and 3D -spheroid- cultured CT26 cells. For both culture conditions, the concentration of VEGF was expre...

Ngày tải lên: 18/06/2014, 15:20

... mitotic kinase Aurora- A to be overexpressed in ovarian carcinomas compared to adenomas. Furthermore, we demonstrated the pan- Aurora inhibitor VE-465 can synergize with paclitaxel to induce apoptosis ... purposes) Journal of Translational Medicine Open Access Research Aurora kinase inhibitors synergize with paclitaxel to induce apoptosis in ovari...

Ngày tải lên: 18/06/2014, 15:20

... preprocessing of data that included averaging of tech- nical repeats, interpolation of missing or non-aligned points, binning of neighboring points to reduce data com- plexity, removal of the spectral ... resolu- tion of the analyzer operating in the linear mode or might result in overlapping of ions originating from protein/ peptides of very similar molecular masses. I...

Ngày tải lên: 18/06/2014, 15:20

... upon the risk of mother-to-child transmission (MTCT) of Human Immunodeficiency Virus type 1 (HIV-1). The aim of this study was to investigate the influence of genetic variants of TLR 9 gene on MTCT. Methods: ... original work is properly cited. Research Toll-like receptor 9 polymorphisms influence mother-to-child transmission of human immunodefic...

Ngày tải lên: 18/06/2014, 16:20

... using semi-nested primers. The primer set BG1 (TATGGTGGGAGAAGAAATTAGTAAAGG) and BG2 (AATAACCTTATCCTCCTCTATAAAATAACC) were used in the first round and BG2 and BG5 (GGTTGGTTAGTTTTGTTTTGATTAATAG) ... Open Access S110, a novel decitabine dinucleotide, increases fetal hemoglobin levels in baboons (P. anubis) Donald Lavelle 1,2* , Yogen Saunthararajah 1,3 , Kestis Vaitku...

Ngày tải lên: 18/06/2014, 16:20

... Access Treatment combining RU486 and Ad5IL-12 vector attenuates the growth of experimentally formed prostate tumors and induces changes in the sentinel lymph nodes of mice Claudia Raja Gabaglia 1 , Alexandra ... combining RU486 and Ad5IL-12 vector attenuates the growth of experimentally formed prostate tumors and induc...

Ngày tải lên: 18/06/2014, 16:20

... Pharmacol Sin 2006, 27:1153-1158. doi:10.1186/1479-5876-9-11 Cite this article as: Leu et al.: Myocardium-derived conditioned medium improves left ventricular function in rodent acute myocardial infarction. Journal ... Medicine 2011, 9:11 http://www.translational-medicine.com/content/9/1/11 Page 18 of 18 RESEARCH Open Access Myocardium-derived conditioned medium i...

Ngày tải lên: 18/06/2014, 16:20

... of Neuroinflammation Open Access Research Apolipoprotein E-specific innate immune response in astrocytes from targeted replacement mice Izumi Maezawa 1 , Nobuyo Maeda 2 , Thomas J Montine 1 ... role in protecting the brain during innate immune response. J Neu- rosci 2003, 23:5536-5544. 25. Wenk GL, McGann-Gramling K, Hauss-Wegrzyniak B, Ronchetti D, Maucci R, Rosi...

Ngày tải lên: 19/06/2014, 22:20

... the three TR APOE mice. Recovery of dendrite length over the next 48 hr was greater in TR APOE2 than TR APOE3 mice, while TR APOE4 mice had failure of dendrite regeneration. Cell culture experiments ... demonstrated that despite brain regional differences in apoE expression, there are no isoform-specific differences in levels of apoE in brain tissue from these TR APOE mice, even with...

Ngày tải lên: 19/06/2014, 22:20

... cytokines is elevated, the expression of IL -1- driven AD-related proteins such as ApoE would be elevated as well. Multiple MLKs—ERK, p38-MAPK, and JNK—were shown to be involved in elevated expression ... made available soon. Apolipoprotein E expression is elevated by interleukin 1 and other interleukin 1- induced factors Journal of Neuroinflammation 2 01...

Ngày tải lên: 19/06/2014, 22:20

... of 9 (page number not for citation purposes) Virology Journal Open Access Research Kaposi's sarcoma associated herpesvirus G-protein coupled receptor activation of cyclooxygenase-2 in vascular ... vGPCR induces COX-2 expression in primary vascular endothelial cells and may be responsible for the COX-2 and PGE 2 increases observed following infection in mi...

Ngày tải lên: 20/06/2014, 01:20

... hypothesized to involve other mechanisms such as twitching. This idea was reinforced by the findings [8] that inside the spine, the cytoplasmic actin is organized in filaments, involved in various forms ... model of protein trafficking in spines. Biophys. J. 96, 1786–1802 (2009) 57. Bressloff, P.C.: Cable theory of protein receptor trafficking in dendritic trees. Phys. Rev. E, Stat. Non...

Ngày tải lên: 20/06/2014, 23:20

... NMDA-spikes can arise in certain dendritic zones. In the context of reinforcement learning, two kinds of plasticity rules are derived, zone reinforcement (ZR) and cell reinforcement (CR), which ... second integration extending from time t into the future up to t + ∆. The acausality of integrating into the future can be taken care of by time shifting the integration variable in t...

Ngày tải lên: 21/06/2014, 19:20