báo cáo hóa học: " Correction: Microglial inflammation in th

báo cáo hóa học:" Survivin gene levels in the peripheral blood of patients with gastric cancer independently predict survival" doc

... (pooled peripheral blood samples from healthy donors). Survivin gene levels measured in the peripheral blood of 70 patients with TNM stage I to IV gastric cancerFigure 2 Survivin gene levels measured ... transcriptional levels of Sur- vivin measured in the peripheral blood of patients with gastric carcinoma independently correlate with t...

Ngày tải lên : 18/06/2014, 15:20

8
565
0

Báo cáo hóa học: " Endotoxin and CD14 in the progression of biliary atresia" ppt

... to investigate endotoxin levels in patients with BA and the relation of these levels with the expression of the endotoxin receptor, CD14. Methods: The plasma levels of endotoxin and soluble CD14 ... of endotoxin stimulated CD14 production by hepatocytes in the early stage of BA for removal of endotoxin; whereas, endotoxin signaling likely induced...

Ngày tải lên : 18/06/2014, 16:20

14
472
0

báo cáo hóa học: " Occurrence of post traumatic stress symptoms and their relationship to professional quality of life (ProQoL) in nursing staff at a forensic psychiatric security unit: a cross-sectional study" potx

... thus indicating a higher rate of PTSD symptoms at ward A. Generally, compared to normative data, mean Compas- sion Satisfaction scores (CS) were low at all the wards. At ward A; mean CS was 30.2, ... making the patient treatable at a lower security level can explain the low compassion satisfaction scores at ward A, the admission ward. At this particular forensic...

Ngày tải lên : 18/06/2014, 18:20

6
449
0

báo cáo hóa học: " Type D personality in the general population: a systematic review of health status, mechanisms of disease, and work-related problems" docx

... article as: Mols and Denollet: Type D personality in the general population: a systematic review of health status, mechanisms of disease, and work-related problems. Health and Quality of Life ... apparently healthy individuals from the general population. Type D personality and mechanisms of disease Six studies examined behavioral a...

Ngày tải lên : 18/06/2014, 19:20

10
595
0

báo cáo hóa học: " Cognitive interviewing methodology in the development of a pediatric item bank: a patient reported outcomes measurement information system (PROMIS) study" docx

... citation purposes) Health and Quality of Life Outcomes Open Access Research Cognitive interviewing methodology in the development of a pediatric item bank: a patient reported outcomes measurement ... testing as part of the PROMIS Pediatric Item Bank development process. Abbreviations (PROMIS): Patient Reported Outcomes Measurement Info...

Ngày tải lên : 18/06/2014, 19:20

10
480
1

báo cáo hóa học: " Involvement of β-chemokines in the development of inflammatory demyelination" ppt

... strengthening of circulat- ing T cells to VCAM-1 on endothelial cells. Postulating the involvement of chemokines in the integrin-mediated arrest of autoreactive T cells at the BBB, the investigators [3] ... cells in the perivascular space during the recovery phase of an acute event, and may therefore be involved in the regulation of recovery rather than in...

Ngày tải lên : 19/06/2014, 22:20

14
421
0

báo cáo hóa học: " Microglial inflammation in the parkinsonian substantia nigra: relationship to alpha-synuclein deposition" doc

... other clinically defined PD groups. Discussion Our finding of an overall correlation between aSN deposition and MHCII-expressing microglia in the substantia nigra is in line with the finding ... Neuroinflammation Open Access Research Microglial inflammation in the parkinsonian substantia nigra: relationship to alpha-synuclein deposition Emilie Croisier 1 , Lind...

Ngày tải lên : 19/06/2014, 22:20

8
403
0

báo cáo hóa học: " Correction: Microglial inflammation in the parkinsonian substantia nigra: relationship to alpha-synuclein deposition" pptx

Ngày tải lên : 19/06/2014, 22:20

1
196
0

báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc

... Forward CCTTCCAGGATGAGGACATGA 71 bp NM_008361.3 interleukin 1 beta Reverse TGAGTCACAGAGGATGGGCTC IL-6 Forward GAGGATACCACTCCCAACAGACC 141 bp NM_031168.1 interleukin 6 Reverse AAGTGCATCATCGTTGTTCATACA IL-12 ... TGTACAGAGCTCCACGGCTG CiiTA Forward GCATGTTGCACACCAGCTCCCT 135 bp NM_007575.2 major histocompatibility complex class II transactivator Reverse ACGCCAGTCTGACGAAGGTCCA COX-2 Forward CAGACA...

Ngày tải lên : 19/06/2014, 22:20

8
447
0

báo cáo hóa học: " Lipopolysaccharide induced inflammation in the perivascular space in lungs" docx

... 8:71-88. 16. Singh B, Shinagawa K, Taube C, Gelfand EW, Pabst R: Strain-specific differences in perivascular inflammation in lungs in two murine models of allergic airway inflammation. Clin Exp Immu- nol ... 2). The total number of leukocytes showed a gradual increase in the LPS groups beginning 6 hrs after the challenge reaching significance after 36 hours. In contrast,...

Ngày tải lên : 20/06/2014, 00:20

5
363
0

báo cáo hóa học:" Mechanically-induced osteogenesis in the cortical bone of pre- to peripubertal stage and peri- to postpubertal stage mice" ppt

... puberty and endocortical expansion in the postpubertal stage [8,10], but the effects of loading and estrogen may be independent of each other [11]. The aim of this study is to further examine the ... would serve to increase the ability of the bone to resist bending forces in exercised mice relative to controls because there is more bone mass further...

Ngày tải lên : 20/06/2014, 01:20

5
304
0

Báo cáo hóa học: " Constancy and diversity in the flavivirus fusion peptide Stephen J Seligman" ppt

... the implications of the fusion peptide differences between CFRV and the other flaviviruses? The changes in eight of the 16 amino acids in CFRV in the sequence homologous to the flavivirus fusion ... domain I, four pairs in domain II (including the fusion- peptide related pair) and one pair in domain III were present in both the arthropod-borne fl...

Ngày tải lên : 20/06/2014, 01:20

10
405
0

báo cáo hóa học:" Macrophages and cytokines in the early defence against herpes simplex virus" potx

... replication in most organs, including the liver, spleen, and eventually the brain [284]. The dissemination of infection to the brain and the severity of infection of the peripheral organs depend in part ... of the host, it will be in both interests, including the virus, to settle the conflict amicably. Some important weapons of the unspecific defence and the...

Ngày tải lên : 20/06/2014, 04:20

30
427
0

báo cáo hóa học:" Right thoracic curvature in the normal spine" pdf

... 6:4 http://www.josr-online.com/content/6/1/4 Page 2 of 5 Thoracic right curvature in the normal spine To evaluate the curvature in the normal spine, Cobb angles from T5 to T12 were measured using a standing chest ... normal s pine are unknown. To determine the distribution pattern of thoracic curvature in the normal spine, we measu red the curvature usi...

Ngày tải lên : 20/06/2014, 04:20

5
353
0

Báo cáo hóa học: " Correction: Handoff optimization in 802.11 wireless networks" potx

Ngày tải lên : 21/06/2014, 01:20

1
253
0