báo cáo hóa học: " Effect of pioglitazone treatment in a patient with secondary multiple sclerosis" doc

... frequency of acute exac- erbations and also reduced the rate of decline in the health status, since frequent exacerbations were associated with a more rapid rate of deterioration in health status [13-15]. ... the data and prepared the initial manuscript. MT, TH, AI, HK and TO participated in data collection and the care for the participants. SS and TO performed the sta- tistic...

Ngày tải lên: 18/06/2014, 19:20

... drafting of manuscript. RL: coordination of the study, gathering and processing of data (questionnaires), performed the statistical analyses, drafting and revising of manuscript. JH: participated ... 37:227-236. 32. Janse AJ, Gemke RJBJ, Uiterwaal CS, Tweel I Van der, Kimpen JLL, Sin- nema G: Quality of life; patients and doctors don't always agree: A meta analysis. Journal...

Ngày tải lên: 18/06/2014, 19:20

... data acquisition and analysis and drafting of the manuscript. NF and NT evaluated the data and participated to the manuscript writing. FB, MGR and ML participated to data acquisition and analysis. All authors ... the case, an increased visual processing relative to the final phase of the preceding movement could be associated with a gaze-hand lead magnitude stabilization by means of...

Ngày tải lên: 19/06/2014, 08:20

... rsecoli@uci.edu 2 Biomechatronic Lab., Departments of Mechanical and Aerospace Engineering, University of California, 4200 Engineering Gateway, Irvine, CA 92697-3875 Irvine, USA Full list of author information is available ... during a standard robot-assisted movement training task. This effect was greater for the hemiparetic arm, suggesting that the increased demands associated wi...

Ngày tải lên: 19/06/2014, 08:20

... each variable analyzed Individual kinematic data in RHD and LHD patient groups with and without feedbackFigure 4 Individual kinematic data in RHD and LHD patient groups with and without feedback. ... ischemic, Haem = haemorrhagic, Apraxia(+) = mild, Apraxia(++) = interferes with ADL, Aphasia score according to the Boston Diagnostic Aphasia Examination. Journal of NeuroEnginee...

Ngày tải lên: 19/06/2014, 08:20

... study, participated in data collection and analysis, and manuscript writing; FM participated in data analysis, statistical analysis and manuscript writing; FZ participated in the definition of criteria ... under any treatment. cLBP patients were defined according to clinical examination and duration of pain [40-42], and all of them performed an X-ray to exclude secondary cLBP....

Ngày tải lên: 19/06/2014, 08:20

... not separated into stages 4 and 4S since 4S is for infants INSS (International Neuroblastoma Staging System) according to Simpson and Gaze [27] at autopsy Journal of Translational Medicine 2009, ... was analyzed by MS. RC contributed with data interpretation and drafting of the manuscript written by DF and FA. EL and MS provided input in writing of the manuscript. All authors read...

Ngày tải lên: 18/06/2014, 15:20

... Pouchitis and extraintestinal manifestations of inflammatory bowel disease after ileal pouch-anal anastomosis. Ann Surg 1990, 211(5):622-629. 15. Hata K, Watanabe T, Shinozaki M, Nagawa H: Patients with ... fact that both inflammatory and apoptosis pathways are related. Furthermore, the major pathway of apoptosis in these cases were intrinsic mitochondrial pathway char- acterized by A...

Ngày tải lên: 18/06/2014, 16:20

... Utrophin was taken from Arning et al. [29] (Forward 5' aaggacctggtcaacgttcca 3', Reverse 5' acccgtgtcatagacattgagca 3'). The Beta-Actin mRNA level was used as control for normalization ... normalization of samples (For- ward 5#8242; gacaggatgcagaaggagattact 3', Reverse 5#8242; tgatccacatctgctggaaggt 3'). Nothern Blot analysis Given the limited amount of RNA a...

Ngày tải lên: 18/06/2014, 16:20

... board of the Istituto Oncologico Veneto, in accordance with the ethi- cal standards of Helsinki Declaration. Cyclosporin A (CsA, Sandoz Pharmaceuticals AG; Cham, Switzerland) was initially added ... involved in cytotoxicity. CD4 + T cell line cytotoxicity was evaluated in the presence of CMA and EGTA that block perforin-based pathway, and BFA and anti-FasL mAb that interfere...

Ngày tải lên: 18/06/2014, 16:20