báo cáo hóa học: " Effect of pioglitazone treatment in a patient with secondary multiple sclerosis" doc
báo cáo hóa học: " Effect of exacerbations on health status in subjects with chronic obstructive pulmonary disease" doc
... frequency of acute exac-
erbations and also reduced the rate of decline in the
health status, since frequent exacerbations were associated
with a more rapid rate of deterioration in health status
[13-15]. ... the data and prepared the initial manuscript.
MT, TH, AI, HK and TO participated in data collection and
the care for the participants. SS and TO performed the sta-
tistic...
báo cáo hóa học: " Effect of dexamethasone on quality of life in children with acute lymphoblastic leukaemia: a prospective observational study" pdf
... drafting of manuscript. RL: coordination of the
study, gathering and processing of data (questionnaires),
performed the statistical analyses, drafting and revising of
manuscript. JH: participated ... 37:227-236.
32. Janse AJ, Gemke RJBJ, Uiterwaal CS, Tweel I Van der, Kimpen JLL, Sin-
nema G: Quality of life; patients and doctors don't always
agree: A meta analysis. Journal...
Báo cáo hóa học: " Effect of terminal accuracy requirements on temporal gaze-hand coordination during fast discrete and reciprocal pointings" doc
... data
acquisition and analysis and drafting of the manuscript. NF and NT
evaluated the data and participated to the manuscript writing. FB, MGR and
ML participated to data acquisition and analysis. All authors ... the case, an increased visual processing relative
to the final phase of the preceding movement could be
associated with a gaze-hand lead magnitude stabilization
by means of...
Báo cáo hóa học: " Effect of visual distraction and auditory feedback on patient effort during robot-assisted movement training after stroke" ppt
... rsecoli@uci.edu
2
Biomechatronic Lab., Departments of Mechanical and Aerospace
Engineering, University of California, 4200 Engineering Gateway, Irvine, CA
92697-3875 Irvine, USA
Full list of author information is available ... during a standard robot-assisted movement training
task. This effect was greater for the hemiparetic arm, suggesting that the increased demands associated wi...
báo cáo hóa học: "Effect of auditory feedback differs according to side of hemiparesis: a comparative pilot study" pdf
... each variable analyzed
Individual kinematic data in RHD and LHD patient groups with and without feedbackFigure 4
Individual kinematic data in RHD and LHD patient groups with and without feedback. ... ischemic, Haem = haemorrhagic,
Apraxia(+) = mild, Apraxia(++) = interferes with ADL, Aphasia score according to the Boston Diagnostic Aphasia Examination.
Journal of NeuroEnginee...
báo cáo hóa học: "Effect of obesity and low back pain on spinal mobility: a cross sectional study in women" pptx
... study, participated in data collection and analysis, and
manuscript writing; FM participated in data analysis, statistical analysis and
manuscript writing; FZ participated in the definition of criteria ... under any treatment. cLBP patients were defined
according to clinical examination and duration of pain
[40-42], and all of them performed an X-ray to exclude
secondary cLBP....
báo cáo hóa học:" Regression of orthotopic neuroblastoma in mice by targeting the endothelial and tumor cell compartments" pdf
... not separated into stages 4 and 4S since 4S is for
infants
INSS (International Neuroblastoma Staging System) according to
Simpson and Gaze [27] at autopsy
Journal of Translational Medicine 2009, ... was analyzed by MS. RC contributed with data
interpretation and drafting of the manuscript written by
DF and FA. EL and MS provided input in writing of the
manuscript. All authors read...
Báo cáo hóa học: " Detection of epithelial apoptosis in pelvic ileal pouches for ulcerative colitis and familial adenomatous polyposis" pot
... Pouchitis
and extraintestinal manifestations of inflammatory bowel disease after
ileal pouch-anal anastomosis. Ann Surg 1990, 211(5):622-629.
15. Hata K, Watanabe T, Shinozaki M, Nagawa H: Patients with ... fact that both inflammatory and apoptosis
pathways are related.
Furthermore, the major pathway of apoptosis in
these cases were intrinsic mitochondrial pathway char-
acterized by A...
Báo cáo hóa học: " Overexpression of microRNA-206 in the skeletal muscle from myotonic dystrophy type 1 patients" docx
... Utrophin was taken from Arning et
al. [29] (Forward 5' aaggacctggtcaacgttcca 3', Reverse 5'
acccgtgtcatagacattgagca 3'). The Beta-Actin mRNA level
was used as control for normalization ... normalization of samples (For-
ward 5#8242; gacaggatgcagaaggagattact 3', Reverse
5#8242; tgatccacatctgctggaaggt 3').
Nothern Blot analysis
Given the limited amount of RNA a...
Báo cáo hóa học: " Impact of g-chain cytokines on EBV-specific T cell cultures" doc
... board of the
Istituto Oncologico Veneto, in accordance with the ethi-
cal standards of Helsinki Declaration.
Cyclosporin A (CsA, Sandoz Pharmaceuticals AG;
Cham, Switzerland) was initially added ... involved in cytotoxicity. CD4
+
T cell line cytotoxicity was
evaluated in the presence of CMA and EGTA that block perforin-based pathway, and BFA and anti-FasL mAb that interfere...
Từ khóa: