báo cáo hóa học: " Efficacy of motor imagery in post-stroke rehabilitation: a systematic review" ppt
báo cáo hóa học:" Regression of orthotopic neuroblastoma in mice by targeting the endothelial and tumor cell compartments" pdf
... not separated into stages 4 and 4S since 4S is for infants INSS (International Neuroblastoma Staging System) according to Simpson and Gaze [27] at autopsy Journal of Translational Medicine 2009, ... Stridsberg 3 , Elin Lindhagen 3 and Faranak Azarbayjani 1 Address: 1 Department of Medical Cell Biology, Uppsala University, 75123 Uppsala, Sweden, 2 Department of Woman and Child Heal...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " Detection of epithelial apoptosis in pelvic ileal pouches for ulcerative colitis and familial adenomatous polyposis" pot
... Pouchitis and extraintestinal manifestations of inflammatory bowel disease after ileal pouch-anal anastomosis. Ann Surg 1990, 211(5):622-629. 15. Hata K, Watanabe T, Shinozaki M, Nagawa H: Patients ... fact that both inflammatory and apoptosis pathways are related. Furthermore, the major pathway of apoptosis in these cases were intrinsic mitochondrial pathway char- acterized by APAF-1 a...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " Overexpression of microRNA-206 in the skeletal muscle from myotonic dystrophy type 1 patients" docx
... Utrophin was taken from Arning et al. [29] (Forward 5' aaggacctggtcaacgttcca 3', Reverse 5' acccgtgtcatagacattgagca 3'). The Beta-Actin mRNA level was used as control for normalization ... normalization of samples (For- ward 5#8242; gacaggatgcagaaggagattact 3', Reverse 5#8242; tgatccacatctgctggaaggt 3'). Nothern Blot analysis Given the limited amount of RNA a...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: " Utility of WHOQOL-BREF in measuring quality of life in Sickle Cell Disease" docx
... contributed substantially to study design, data collection, analysis of data and preparation of the manuscript. All authors have also read and approved the final manuscript. Acknowledgements The authors ... Faculty of Medical Sciences Ethics Commit- tee. Statistical approach All data were initially captured into Epidata ® for Windows and then analyzed with Stata™ statistical software f...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Identification of symptom domains in ulcerative colitis that occur frequently during flares and are responsive to changes in disease activity" ppt
... quadrant of Table 2). Anorexia was an example of a symptom domain that did not fulfill this study's criteria. In the case of the symptom domain anorexia, 34 of 60 individuals had a VAS rating greater ... UC disease activity indices are rarely Visual analogue scale ratings of symptoms that are absent during remissionFigure 5 Visual analogue scale ratings of symptoms that...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo khoa học: Abundance of intrinsic disorder in SV-IV, a multifunctional androgen-dependent protein secreted from rat seminal vesicle pot
... that high recognition accuracy can be obtained by an SVM that incorporates only amino acid composition, and very good recogni- tion accuracy was retained using reduced sets of amino acids based ... Catalanotti P, Baroni A & Metafora S (1996) Rat seminal vesicle protein SV-IV and its transglutaminase-synthesized polyaminated derivative Spd 2 -SV-IV induce cytokine release from human .....
Ngày tải lên: 23/03/2014, 07:20
Báo cáo sinh học: " Effect of oligonucleotide primers in determining viral variability within hosts" ppt
... determining viral variability within hosts Maria Alma Bracho* † , Inmaculada Garc a- Robles † , Nuria Jiménez, Manuela Torres-Puente, Andrés Moya and Fernando González-Candelas Address: Institut ... 1 CGCATGGCATGGRATATGAT 2 2-Eg1 1290–1309 2 CGCATGGCYTGG GAYATGAT 4 1-Eg2 1300–1321 1 GG RATATGATGATGAACTGGTC 2 2-Eg2 1300–1321 2 GG GATATGATRATGAAYTGGTC 4 1-Ea 1873–1854 1 GGAGTGAAGCARTATACTGG ....
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt
... who practiced either a ballistic or a ramp pinch task, an increase in force and acceleration, asso- ciated with an increase in MEP amplitude, was observed in the muscle involved in the training, ... cortical inhibition are therefore appealing for augmenting motor learning in behavioral therapies [38-40]. Here we present data supporting the idea that depending on the nature of...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " Characterization of age-related modifications of upper limb motor control strategies in a new dynamic environment" docx
... subjects could be explained by a mechanism that increases the acti- vation of the prime response or by a process that affect the activation of interfering information that allows the brain to switch between ... Shadmehr R: Generalization as a behavioral window to the neural mechanisms of learning internal models. Hum Mov Sci 2004, 23:543-568. 4. Bhushan N, Shadmehr R: Computationa...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo y học: " Efficacy of the Valsalva Maneuver on Needle Projection Pain and Hemodynamic Responses During Spinal Puncture"
... study. Anesth Analg 2004; 98: 343–5. 7. Agarwal A, Sinha P.K, Tandon M, Dhiraaj S, Singh U. Evaluat- ing the Efficacy of the Valsalva Maneuver on Venous Cannula- tion Pain: A Prospective, Randomized ... pro- duce pain on injection and many anesthetists are un- sure that infiltration analgesia at the site of spinal puncture has any advantage over a straightforward puncture withou...
Ngày tải lên: 25/10/2012, 11:15