báo cáo hóa học: " A kinematic analysis of a haptic handheld stylus in a virtual environment: a study in healthy subjects" pptx
Báo cáo hóa học: " Gait kinematic analysis in patients with a mild form of central cord syndrome" pdf
... Consejer a of Sanidad of the Junta of Comunidades of Castilla-La Mancha (Spain) and FISCAM PI 2006/44 (Spain).The authors thank Dr. Antonio Sánchez-Ramos (Head of Department of Physical Medicine and ... calcu-lated as the average of the values obtained in the fivetrials considered. A descriptive analysis was made of theclinical and functional variables by calculating the meanand standard deviation ... there are many parameters that can beobtained from gait analysis, it is necessary to take intoaccount the reliability of measurements in di fferentjoint planes. In marker based gait analysis, ...
- 10
- 440
- 0
báo cáo hóa học: " Internal construct validity of the Warwick-Edinburgh Mental Well-being Scale (WEMWBS): a Rasch analysis using data from the Scottish Health Education Population Survey" potx
... model, a mean of approxi-mately zero and a standard deviation of 1 would beexpected. A third is an item-trait interaction statisticreported as a Chi-Square, reflecting the property of invar-iance ... For example, in the case of measuring mental well-being, males andfemales should have the same probability of affirming anitem (in the dichotomous case), at the same level of mentalwell-being. ... construct validity of the Warwick-Edinburgh Mental Well-being Scale (WEMWBS): a Rasch analysis using data from the Scottish Health Education Population SurveySarah Stewart-Brown*1, Alan Tennant2,...
- 8
- 462
- 0
báo cáo hóa học:" The biomechanical analysis of three plating fixation systems for periprosthetic femoral fracture near the tip of a total hip arthroplasty" docx
... in the literature acted as a precedent forsimilar load levels and/or regimes [1,4,17-24].Statistical Analysis Stiffness data (left femurs) were expressed as a percentage of baseline of intact ... than cable-plate systems in 4 of 5 test modes andequally stiff in 1 of 5. A surgical advantage of screw fixa-tion is that no circumferential tissue stripping is required,as in the case of cables ... values that werelower than intact controls, except in a few instances. For a given construct, screw-plate systems were stiffer thancable-plate systems in about half of all cases assessed andwere...
- 8
- 336
- 0
báo cáo hóa học:" Anti-tumor activity of patient-derived NK cells after cell-based immunotherapy – a case report" doc
... purposes)line phosphatase, γ-glutamine transferase, alanine ami-notranferease (ALT), aspartate aminotransferase (AST),lactate dehydrogenase, Quick, and aPTT were determinedbefore each leukapheresis. ... presence of infiltratingmemory and effector T cells in human colorectal cancercorrelates with the signs of early metastatic invasion, a lessadvanced pathological stage and an increased survival[23] ... cytolytic activity of ex vivoTKD/IL-2-activated PBMNC against a classical NK targetand the autologous, Hsp70 membrane-positive tumor of a patient with an anastomotic relapse of a colon adenocar-cinoma...
- 18
- 541
- 0
Báo cáo hóa học: "Microrna profiling analysis of differences between the melanoma of young adults and older adults" pot
... Bank,isolated RNA, conducted TLDA assays and organized raw data, equalcontribution as first author. JSS carried out microRNA analysis and assisted in interpreting the data (using ABqPCR software). ... materials and methods). N /A: not applicable.Table 7 Summary Of Number Of Mirs Identified By Class Comparison Analysis I and IIClassComparisonArray A aArrayB a Total # of significant MiRs Array A+ B Analysis ... Primary melanoma in patients greater than 60 years old was characterized by the increased expression of miRs regulating TLR-MyD88-NF-kappaB pathway (hsa-miR-19 9a) , RAS/RAB2 2A pathway (hsa-miR-204);...
- 23
- 543
- 0
báo cáo hóa học:" Site-specific analysis of gene expression in early osteoarthritis using the Pond-Nuki model in dogs" pot
... CondyleCranial Lateral Femoral Condyle Caudal Lateral Femoral CondyleCaudal Lateral Tibial PlateauCranial Lateral Tibial PlateauCaudal Medial Tibial PlateauCranial Medial Tibial PlateauJournal ... ATGCCGAATTCCTGGTCTGGTIMP 1 FOR GCAGAAGTCAACCAGACCGA 311 86.2RC GCAAGTATCCGCAGACGCTCTIMP 2 FOR AACGGCAAGATGCACATCAC 142 85.5RC ATATAGCACGGGATCATGGGINOS FOR GCTATGCTGGCTACCAGATG 139 88.3RC ATCAGCCTGCAGCACCAGAGCOX-2 ... ATCAGCCTGCAGCACCAGAGCOX-2 FOR ACACTCTACCACTGGCATCC 196 83.5RC GCTACTTGTTGTACTGCAGCMMP-1 FOR CCTAGAACCGTGAAGAGCAT 150 80RC CAGGAAAGTCAGCTGCTATCMMP 3 FOR ATGGCATCCAGTCCCTGTAT 161 86.5RC AAAGAACAGGAACTCTCCCCMMP...
- 12
- 521
- 0
Báo cáo hóa học: " Quantitative expression analysis of HHV-6 cell receptor CD46 on cells of human cord blood, peripheral blood and G-CSF mobilised leukapheresis cells" docx
... to study design and mainly revised themanuscript.WS composed the initial conception and contributed todata interpretation and manuscript revision.All authors read and approved the final manuscript.AcknowledgementsWe ... Seya T, Hara T, Matsumoto M, Akedo H: Quantitative analysis of membrane cofactor protein (MCP) of complement. Highexpression of MCP on human leukemia cell lines, which isdown- regulated during ... isalso known to act as a membrane cofactor for factor-I pro-teolytic cleavage of C3b and C4b in complement activa-tion. CD46 also affects various cellular activities in response to pathogen or complement...
- 4
- 272
- 0
báo cáo hóa học:" Probability distribution analysis of M-QAM-modulated OFDM symbol and reconstruction of distorted data" potx
... second case, deliberate clipping makes an intentional noise whichfalls both in- band and out -of- band. In- band distortion results in an error performance degradation, whileout -of- band radiation ... introduced for two main reasons: nonlinear amplifier [1, 2] and/or deliberateclipping [3]. For the first case, if an OFDM symbol is amplified in the saturation area of an amplifier, itsdata recovery is ... imaginary parts. In this article,we analyze the exact PD of M-QAM/OFDM symbols with N subcarriers. We show the general expression of the characteristic function of the time domain samples of...
- 20
- 435
- 0
báo cáo hóa học:" Eco-epidemiological analysis of dengue infection during an outbreak of dengue fever, India" pdf
... Chakravarti* and Rajni KumariaAddress: Department of Microbiology, Maulana Azad Medical College, Associated Lok Nayak Hospital, Bahadur Shah Zafar Marg New Delhi-110002, IndiaEmail: Anita ... variations in A. Aegyptipopulation in Delhi, India. Dengue Bull 1996, 20:78-81.15. Kumar RR, Kamal S, Patnaik SK, Sharma RC: Breeding habitats andlarval indices of Aedes aegypti (L) in residential areas ... Chakravarti* - dochak@yahoo.com; Rajni Kumaria - rajnikumaria@yahoo.com* Corresponding author Dengue InfectionDengue feverIndiaRainfallTemperatureRelative humidityAbstractBackground: This study...
- 7
- 228
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròbáo cáo khoa họcbáo cáo y họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP