báo cáo hóa học: " A kinematic analysis of a haptic handheld stylus in a virtual environment: a study in healthy subjects" pptx

Báo cáo hóa học: " Gait kinematic analysis in patients with a mild form of central cord syndrome" pdf

Báo cáo hóa học: " Gait kinematic analysis in patients with a mild form of central cord syndrome" pdf

... Consejer a of Sanidad of the Junta of Comunidades of Castilla-La Mancha (Spain) and FISCAM PI 2006/44 (Spain). The authors thank Dr. Antonio Sánchez-Ramos (Head of Department of Physical Medicine and ... calcu- lated as the average of the values obtained in the five trials considered. A descriptive analysis was made of the clinical and functional variables by calculatin...

Ngày tải lên: 19/06/2014, 08:20

10 440 0
báo cáo hóa học: " Internal construct validity of the Warwick-Edinburgh Mental Well-being Scale (WEMWBS): a Rasch analysis using data from the Scottish Health Education Population Survey" potx

báo cáo hóa học: " Internal construct validity of the Warwick-Edinburgh Mental Well-being Scale (WEMWBS): a Rasch analysis using data from the Scottish Health Education Population Survey" potx

... model, a mean of approxi- mately zero and a standard deviation of 1 would be expected. A third is an item-trait interaction statistic reported as a Chi-Square, reflecting the property of invar- iance ... For example, in the case of measuring mental well-being, males and females should have the same probability of affirming an item (in the dichotomous case), at the same le...

Ngày tải lên: 18/06/2014, 19:20

8 462 0
báo cáo hóa học:" The biomechanical analysis of three plating fixation systems for periprosthetic femoral fracture near the tip of a total hip arthroplasty" docx

báo cáo hóa học:" The biomechanical analysis of three plating fixation systems for periprosthetic femoral fracture near the tip of a total hip arthroplasty" docx

... in the literature acted as a precedent for similar load levels and/or regimes [1,4,17-24]. Statistical Analysis Stiffness data (left femurs) were expressed as a percentage of baseline of intact ... than cable-plate systems in 4 of 5 test modes and equally stiff in 1 of 5. A surgical advantage of screw fixa- tion is that no circumferential tissue stripping is required,...

Ngày tải lên: 20/06/2014, 04:20

8 337 0
báo cáo hóa học:" Anti-tumor activity of patient-derived NK cells after cell-based immunotherapy – a case report" doc

báo cáo hóa học:" Anti-tumor activity of patient-derived NK cells after cell-based immunotherapy – a case report" doc

... purposes) line phosphatase, γ-glutamine transferase, alanine ami- notranferease (ALT), aspartate aminotransferase (AST), lactate dehydrogenase, Quick, and aPTT were determined before each leukapheresis. ... presence of infiltrating memory and effector T cells in human colorectal cancer correlates with the signs of early metastatic invasion, a less advanced pathological stage and an in...

Ngày tải lên: 18/06/2014, 15:20

18 542 0
Báo cáo hóa học: "Microrna profiling analysis of differences between the melanoma of young adults and older adults" pot

Báo cáo hóa học: "Microrna profiling analysis of differences between the melanoma of young adults and older adults" pot

... Bank, isolated RNA, conducted TLDA assays and organized raw data, equal contribution as first author. JSS carried out microRNA analysis and assisted in interpreting the data (using ABqPCR software). ... materials and methods). N /A: not applicable. Table 7 Summary Of Number Of Mirs Identified By Class Comparison Analysis I and II Class Comparison Array A a Array B a Total # of...

Ngày tải lên: 18/06/2014, 16:20

23 543 0
báo cáo hóa học:" Site-specific analysis of gene expression in early osteoarthritis using the Pond-Nuki model in dogs" pot

báo cáo hóa học:" Site-specific analysis of gene expression in early osteoarthritis using the Pond-Nuki model in dogs" pot

... Cond y le Cranial Lateral Femoral Condyle Caudal Lateral Femoral Cond y le Caudal Lateral Tibial Plateau Cranial Lateral Tibial Plateau Caudal Medial Tibial Plateau Cranial Medial Tibial Plateau Journal ... ATGCCGAATTCCTGGTCTGG TIMP 1 FOR GCAGAAGTCAACCAGACCGA 311 86.2 RC GCAAGTATCCGCAGACGCTC TIMP 2 FOR AACGGCAAGATGCACATCAC 142 85.5 RC ATATAGCACGGGATCATGGG INOS FOR GCTATGCTGGCTACCAGATG...

Ngày tải lên: 20/06/2014, 00:20

12 522 0
Báo cáo hóa học: " Quantitative expression analysis of HHV-6 cell receptor CD46 on cells of human cord blood, peripheral blood and G-CSF mobilised leukapheresis cells" docx

Báo cáo hóa học: " Quantitative expression analysis of HHV-6 cell receptor CD46 on cells of human cord blood, peripheral blood and G-CSF mobilised leukapheresis cells" docx

... to study design and mainly revised the manuscript. WS composed the initial conception and contributed to data interpretation and manuscript revision. All authors read and approved the final manuscript. Acknowledgements We ... Seya T, Hara T, Matsumoto M, Akedo H: Quantitative analysis of membrane cofactor protein (MCP) of complement. High expression of MCP on human leukemia cell lin...

Ngày tải lên: 20/06/2014, 01:20

4 272 0
báo cáo hóa học:" Probability distribution analysis of M-QAM-modulated OFDM symbol and reconstruction of distorted data" potx

báo cáo hóa học:" Probability distribution analysis of M-QAM-modulated OFDM symbol and reconstruction of distorted data" potx

... second case, deliberate clipping makes an intentional noise which falls both in- band and out -of- band. In- band distortion results in an error performance degradation, while out -of- band radiation ... introduced for two main reasons: nonlinear amplifier [1, 2] and/or deliberate clipping [3]. For the first case, if an OFDM symbol is amplified in the saturation area of an amplifier, its...

Ngày tải lên: 20/06/2014, 04:20

20 435 0
báo cáo hóa học:" Eco-epidemiological analysis of dengue infection during an outbreak of dengue fever, India" pdf

báo cáo hóa học:" Eco-epidemiological analysis of dengue infection during an outbreak of dengue fever, India" pdf

... Chakravarti* and Rajni Kumaria Address: Department of Microbiology, Maulana Azad Medical College, Associated Lok Nayak Hospital, Bahadur Shah Zafar Marg New Delhi- 110002, India Email: Anita ... variations in A. Aegypti population in Delhi, India. Dengue Bull 1996, 20:78-81. 15. Kumar RR, Kamal S, Patnaik SK, Sharma RC: Breeding habitats and larval indices of Aedes aegypti (L) in r...

Ngày tải lên: 20/06/2014, 04:20

7 228 0
w