báo cáo hóa học: "Initial development and testing of a novel foam-based pressure sensor for wearable sensing" doc

báo cáo hóa học: "Initial development and testing of a novel foam-based pressure sensor for wearable sensing" doc

báo cáo hóa học: "Initial development and testing of a novel foam-based pressure sensor for wearable sensing" doc

... Access Research Initial development and testing of a novel foam-based pressure sensor for wearable sensing Lucy E Dunne* 1 , Sarah Brady 2 , Barry Smyth 1 and Dermot Diamond 2 Address: 1 Adaptive Information ... between approximately 2 kΩ and 4 kΩ. These are absolute values and a low total change compared to the other sensors. This is a result of the age o...

Ngày tải lên: 19/06/2014, 10:20

7 748 0
báo cáo hóa học: " The design and testing of a novel mechanomyogram-driven switch controlled by small eyebrow movements" docx

báo cáo hóa học: " The design and testing of a novel mechanomyogram-driven switch controlled by small eyebrow movements" docx

... was adjusted for each participant such that false activations due to blinks and movement were avoided and participants were able to activate the switch by raising their eyebrows with minimal effort. ... frontalis muscle during quick and sustained eye-brow raises, eye blinks and head move- ment. JNER JOURNAL OF NEUROENGINEERING AND REHABILITATION Alves and Chau Journal of Neu...

Ngày tải lên: 19/06/2014, 08:20

10 501 0
báo cáo hóa học:" The development and validation of the daily electronic Endometriosis Pain and Bleeding Diary" pdf

báo cáo hóa học:" The development and validation of the daily electronic Endometriosis Pain and Bleeding Diary" pdf

... eligible. Clinical Assessments and PRO Measures Clinical and demographic data were collected at baseline. Clinical data included date and method of endometriosis diagnosis; date of any surgical treatments for ... and dyspareunia. Because it is a patient- reported daily assessment, the EPBD overcomes the sig- nificant potential for intra- and inter-rater variability and r...

Ngày tải lên: 20/06/2014, 16:20

9 289 0
Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

... GGCGCGACG CACGAAAATTACGC K270H-R GTCTATTTTCACGCAAAGCACCCGGT R403Y-F AAACCGATTTG TACATCGCATTTTC R403Y-R CATTAATGGATATCGTTCCGATTCC H J. Wu et al. Identification of a new aspartate aminotransferase FEBS ... V max and k cat were determined for the purified AATB3. Values for K m and V max for both amino donors (l-aspartate and l-glutamate) and ac- ceptors (a- ketoglutarate and ox...

Ngày tải lên: 14/03/2014, 23:20

13 490 0
Báo cáo khoa học: cDNA cloning and characterization of a novel calmodulinlike protein from pearl oyster Pinctada fucata potx

Báo cáo khoa học: cDNA cloning and characterization of a novel calmodulinlike protein from pearl oyster Pinctada fucata potx

... nucleotide sequence of oyster CaLP cDNA obtained by RACE, a PCR reaction was performed using a pair of specific primers P3 (5¢-GGAAGAATACAGACACGGACAG-3¢) and P4 (5¢-ATAACAACAGTTTATACATCGCTTC-3¢) correspon- ding ... Taq DNA polymerase, and 20 pm of each primer G1 (5¢-ATGGCGGAAGATC TCACAGAAGAACAAA-3¢) and G2 (5¢-TCATTTATTTT CTTGTTGCTGTTC-3¢). Preliminary experiments showed that...

Ngày tải lên: 16/03/2014, 23:20

12 375 0
Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx

Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx

... database, i.e. Avicennia (BAB16317), Nicotiana secretory peroxidases (AAD33072), cotton (COTPROXDS) (AAA99868), barley grain (BP1) (AAA32973), Ar. thaliana (ATP 2A) A2 (Q42578) and HRP-C (AAA33377). ... Authors Journal compilation ª 2007 FEBS 1297 Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus Santosh Kumar, Ajaswrata Dutta, Alo...

Ngày tải lên: 23/03/2014, 09:21

14 347 0
Báo cáo Y học: Identification and characterization of a novel activated RhoB binding protein containing a PDZ domain whose expression is specifically modulated in thyroid cells by cAMP pot

Báo cáo Y học: Identification and characterization of a novel activated RhoB binding protein containing a PDZ domain whose expression is specifically modulated in thyroid cells by cAMP pot

... rho-binding domain. J. Biol. Chem 271, 13556–13560. 15. Ishizaki, T., Maekawa, M., Fujisawa, K., Okawa, K., Iwamatsu, A. ,Fujita ,A. ,Watanabe,N.,Saito,Y.,Kakizuka ,A. ,Morii,N.& Narumiya, S. (1996) The small ... redistribution of both actin microfilaments and cytokeratin intermediate filaments, and with the appearance of a marked cytokeratin and actin immunoreactivity at the c...

Ngày tải lên: 23/03/2014, 21:20

9 394 0
báo cáo hóa học:"On quotients and differences of hypergeometric functions" pptx

báo cáo hóa học:"On quotients and differences of hypergeometric functions" pptx

... below). For information about publishing your research in Journal of Inequalities and Applications go to http://www.journalofinequalitiesandapplications.com/authors/instructions/ For information about ... intriguing is the zero-balanced case. For example, (2011) Abramowitz, M, Stegun, IA (eds.): Handbook of Mathematical Functions with Formulas, Graphs 16 References [1] and Mathe...

Ngày tải lên: 18/06/2014, 15:20

17 381 0
báo cáo hóa học:" Birth weight and characteristics of endothelial and smooth muscle cell cultures from human umbilical cord vessels" docx

báo cáo hóa học:" Birth weight and characteristics of endothelial and smooth muscle cell cultures from human umbilical cord vessels" docx

... blood pressure in adult life. The molecular and cellular analysis of umbilical cord artery and vein may provide information about the early vascular characteristics of an individual. We have assessed several ... performed using SPSS 13.0 (SPSS Inc, Chicago, Illinois, USA) and GraphPad Statmate 2.0 (GraphPad Software, La Jolla, California, USA) softwares. Results Characteristics o...

Ngày tải lên: 18/06/2014, 15:20

10 432 0
báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx

báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx

... hirohash@sapmed.ac.jp; Hiroshi Kitamura - hkitamu@sapmed.ac.jp; Eiji Sato - eiji@sapmed.ac.jp; Naoya Masumori - masumori@sapmed.ac.jp; Yasuaki Tamura - ytamura@sapmed.ac.jp; Taiji Tsukamoto - taijit@sapmed.ac.jp; ... of Japan, a grant-aid for Clinical Cancer Research from the Ministry of Health, Labor and Welfare of Japan (2006), a research grant of the Stiftelsen Japanese...

Ngày tải lên: 18/06/2014, 15:20

11 531 0
w