báo cáo hóa học: " A swimming robot actuated by living muscle tissue" docx
... between muscle removal from the animal to finalizing the muscle installation into the robotic swimmer was approximately 1 hour. Table I: Muscle actuator parameters and swimming robot performance parameters ... and functional adaptation of the biological component. Based upon functional performance, muscle is potentially an excellent mechanical actuator, but the larger challenge of...
Ngày tải lên: 19/06/2014, 10:20
... state-of-the-art, commercial vendors, and open issues and challenges. A. Advantages and applications BCSs and CB offer several advantages over generic bio- metric systems. Most important advantages are ... element (real-valued feature vectors are required). These inter- vals are encoded and stored as helper data. At the time of authentication, again, biometric characteristics of a subject...
Ngày tải lên: 20/06/2014, 22:20
... supported by Kyungpook National Universi ty Research Fund, 2010. Author details 1 Department of Mathematics Education, Kyungpook National University Daegu 702-701, South Korea 2 Département de mathématiques, ... National University Daegu 702-701, South Korea Full list of author information is available at the end of the article Abstract This paper performs a further investigation on the q...
Ngày tải lên: 21/06/2014, 00:20
báo cáo hóa học:" A highly invasive human glioblastoma pre-clinical model for testing therapeutics" pot
... bknudsen@fhcrc.org; Sandra Cottingham - sandra.cottingham@spectrum-health.org; Ping Zhao - ping.zhao@vai.org; Karl Dykema - karl.dykema@vai.org; Brian Cao - brian.cao@vai.org; James Resau - james.resau@vai.org; ... material Acknowledgements We are grateful to Drs. David Wenkert and Yuehai Shen for 17AAG char- acterization and to Drs. Jacob Zhang and Kyle Furge for statistical analysis. We t...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" A systematic approach to biomarker discovery; Preamble to "the iSBTc-FDA taskforce on immunotherapy biomarkers"" docx
... Yang H, Wang S, Xie S, Liu Q, Liu T, Huang J, Xie W, Li Z, Zhao Y, Wang E, Marincola FM, Yao K: Tran- scriptional patterns, biomarkers and pathways characteriz- ing nasopharyngeal carcinoma of Southern ... cul- ture and expansion. J Transl Med 2006, 4:40. 37. Maecker HT, Hassler J, Payne JK, Summers A, Comatas K, Ghanayem M, Morse MA, Clay TM, Lyerly HK, Bhatia S, Ghanekar SA, Maino VC, Del...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" A novel role of HLA class I in the pathology of medulloblastoma" docx
... 5'- ATATGGATCCATCTCAGTCCCTCACAAGA-3' (HLA -A) , 5'-TATAGTCGACCACCCGGACTCAGAGTCTCCT-3' and 5'-ATATGGATCCATCTCAGTCCCTCACAAGA-3' (HLA- B), 5'-ACCTGTACGCCAACACAGTG-3' and 5'-GCCAT- GCCAATCTCATCTT-3' ... 5'-GGACGTAGGG- TAAACGTCAGC-3' (TAP2), 5'-CTCGCGCTACTCTCTCTT- 3' and 5'-AAGACCAGTCCTTGCTGA-3' (β2m), 5'-TAT- AGT...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx
... 360(9331):427-435. 14. Miyamoto K, Nishigami K, Nagaya N, Akutsu K, Chiku M, Kamei M, Soma T, Miyata S, Higashi M, Tanaka R, Nakatani T, Nonogi H, Take- shita S: Unblinded pilot study of autologous transplantation ... Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients with limb ischaemia by autologous transplantation of bone- marrow cells: a pilot study and a random...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" A comparison of classification methods for predicting Chronic Fatigue Syndrome based on genetic data" potx
... data as testing data and different nine-tenths of the data as training data. Finally, the average estimate over all runs was reported by running the above regular 10-fold cross-validation for 100 ... adopted AUC for evaluating predictive ability of classifiers owing to the fact that AUC is a better performance metric than accuracy [31]. In this study, AUC was used as a value to compare...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf
... sepsis. Intensive Care Med 2001, 27:1412-1415. 24. Martinez A, Orozco G, Varade J, Sanchez LM, Pascual D, Balsa A, Gar- cia A, de la Concha EG, Fernandez-Gutierrez B, Martin J, Urcelay E: Macrophage migration ... malarial anemia. J Infect Dis 2009, 200:629-637. 36. Dhanantwari P, Nadaraj S, Kenessey A, Chowdhury D, Al-Abed Y, Miller EJ, Ojamaa K: Macrophage migration inhibitory factor ind...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac Seo et al. ... (’5to3’) SEA M18970 cttgtacatatgagcgagaaaagcgaagaa gcgcggatccttaacttgtatataaata SED M28521 cgttctcgagaatgaaaacattgattc cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaa...
Ngày tải lên: 18/06/2014, 16:20