báo cáo hóa học: "Introducing a feedback training system for guided home rehabilitation" potx
... mathematical parameters calcu- lated from the measured force values. For all parameters, the mean values as well as the var- iances were calculated. For evaluating the differences in the parameters ... mobile training system that allows home training and provides sufficient guidance and control t o the patient. In this paper a smart user-tailored Feedback Training System (...
Ngày tải lên: 19/06/2014, 08:20
... global asymptotic stability Before stating the oscillation and non-oscillation of solutions, we need the following key lemmas. For any integer a, denote N a = {a, a + 1, ,}. 3.1 Four Lemmas Lemma ... South China, Hengyang, Hunan 421001, People’s Republic of China Full list of author information is available at the end of the article Abstract In this paper, we consider the rule of traje...
Ngày tải lên: 20/06/2014, 22:20
... that when they are formulated loosely, as in the pre- vious paragraph, they appear to conflict. In par- ticular, in ( 2a) , Right Association seems to call for the parse that makes for Mary a ... syntac- tic, semantic, and lexical rules are applied by a bottom-up all-paths constituent parser to populate a chart with edges containing syntactic, seman- tic, and logical form i...
Ngày tải lên: 20/02/2014, 21:20
Tài liệu Báo cáo khoa học: "TOWARDS A DICTIONARY SUPPORT ENVIRONMENT FOR REAL TIME PARSING" potx
... to domain knowledge already encoded in the knowledge base of a limited domain natural language application such as a database query system. Given a hand-coded hierarchical organization of ... critiquing system& apos;, IBM Systems Journal, vol.21, 305- 326 Kaplan, R. and Bresnan, J.(1982) 'Lexical-Functional Grammar: A Formal System for Grammatical Representation&a...
Ngày tải lên: 22/02/2014, 09:20
báo cáo hóa học:" Tremorgenesis: a new conceptual scheme using reciprocally innervated circuit of neurons" pptx
... within the basal ganglia system, especially the pallidum and the subthalamic nucleus, but are mainly synchronized by cortical activity via the striatal inputs. There is an abnormal coupling between ... tremor Tool Parameter analyzed Clinical scales Clinical scores of disability Videos Clinical characterization of tremor Quantification of drawings Evaluation of tremor in 2 dimensions Surface...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" HLA-A" doc
... kawaguch@sapmed.ac.jp; Toshihiko Torigoe - torigoe@sapmed.ac.jp; Akari Takahashi - atakahashi@sapporo.jst-plaza.jp; Masaki Murase - murasem@sapmed.ac.jp; Masanobu Kano - kanomasa@sapmed.ac.jp; Takuro ... Takuro Wada - twada@sapmed.ac.jp; Mitsunori Kaya - mkaya@sapmed.ac.jp; Satoshi Nagoya - nagoya@sapmed.ac.jp; Toshihiko Yamashita - tyamasit@sapmed.ac.jp; Noriyuki Sato - nsatou@sapmed.ac.j...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " Introducing the Immunovirology Section of Journal of Translational Medicine" docx
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " Melanoma: A model for testing new agents in combination therapies" doc
... vinblastine, dacarbazine, interleukin-2, and interferon alfa-2b with cisplatin, vinblastine, and dacarbazine alone in patients with metastatic malignant melanoma (E3695): a trial coordinated ... a tumor; for example, combining a DNA repair inhibitor of PARP with a DNA damaging agent may greatly enhance effectiveness in tumors that have already lost one path- way of DNA repair. A...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " Introducing the Cancer Microenvironment Section of Journal of Translational Medicine" pot
... Vidal-Vanaclocha and Witz Journal of Translational Medicine 2010, 8:60 http://www.translational-medicine.com/content/8/1/60 Open Access COMMENTARY © 2010 Vidal-Vanaclocha and Witz; licensee ... fibroblasts, mac- rophages and bone marrow-derived cells; tissue architec- ture and extracellular matrix associated to tumor stromagenesis and angiogenesis; cancer cell dormancy; and community effects...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " S110, a novel decitabine dinucleotide, increases fetal hemoglobin levels in baboons (P. anubis)" potx
... was amplified by two rounds of PCR using semi-nested primers. The primer set BG1 (TATGGTGGGAGAAGAAATTAGTAAAGG) and BG2 (AATAACCTTATCCTCCTCTATAAAATAACC) were used in the first round and BG2 and ... were prepared for high performance liquid chromatograp hy (HPLC) analysis of globin chain expression and DNA was isolated for bisulfite sequence analysis. Baboon Treatments Two baboons (P. anubi...
Ngày tải lên: 18/06/2014, 16:20