Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx
Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx
... Sugita N, Yoshizawa M, Abe K, Tanaka A, Watanabe T, Chiba S, Yambe T, Nitta S: Evaluation of adaptation to visually induced motion sickness based on the maximum cross-correlation between pulse transmission ... of 9 (page number not for citation purposes) Journal of NeuroEngineering and Rehabilitation Open Access Research Could sound be used as a strategy for reduc...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" KSP inhibitor ARRY-520 as a substitute for Paclitaxel in Type I ovarian cancer cells" potx
... con- centrations as described in the results section. Each exper- iment was done in triplicate. Caspase-3/7, -8, and -9 activity assay Caspase activity was measured using Caspase-Glo™ 3/7, 8, or 9 reagents ... "0" designation represents non-treated controls. (a) Activity of capase-3, -8, and -9 was measured using Caspase-Glo assay, and (b) effect on XIAP, Caspase-2, and Bid w...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx
... hirohash@sapmed.ac.jp; Hiroshi Kitamura - hkitamu@sapmed.ac.jp; Eiji Sato - eiji@sapmed.ac.jp; Naoya Masumori - masumori@sapmed.ac.jp; Yasuaki Tamura - ytamura@sapmed.ac.jp; Taiji Tsukamoto - taijit@sapmed.ac.jp; ... carci- noma. Am J Surg Pathol 2001, 25:1397-1404. 7. Rubin MA, Zhou M, Dhanasekaran SM, Varambally S, Barrette TR, Sanda MG, Pienta KJ, Ghosh D, Chinnaiyan AM: alpha-Methylacyl...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học: " Video capture virtual reality as a flexible and effective rehabilitation tool" pot
... other platforms in a number of ways that have great relevance for its use as a tool for rehabilitation evaluation and intervention. Some of these characteristics appear to be advantageous whereas others ... performed signifi- cantly better than the participants with paraplegia. This platform appeared to be suitable for use with people who have paraplegia and it was able to...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học: " Anti-inflammatory therapy by ibudilast, a phosphodiesterase inhibitor, in demyelination of twitcher, a genetic demyelination model" docx
... 5'-AGT- GACAAGCCTGTAGCCCACG-3', TNFα reverse primer: 5'- TTTCTCCTGGTATGAGATAGC-3', TNFR1 forward primer: 5'-CTAAACAGCAGAACCGAGTGT-3', TNFR1 reverse primer: 5'-AGATACGTAGAGTGTCCTTGG-3', TNFR2 ... 5'-AGATACGTAGAGTGTCCTTGG-3', TNFR2 forward primer: 5'-ATAAAGCCACAC- CCACAACCT-3', TNFR2 reverse primer: 5'-CATCTCCCT- GCCACTCACAA-3&apo...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " TLR3 signaling is either protective or pathogenic for the development of Theiler''''s virus-induced demyelinating disease depending on the time of viral infection" docx
... 10 8 PFU and a pooled batch was used as a viral stock. If necessary the viral stock was diluted in DMEM before inoculation. Assessment of clinical signs. Approximately 30 µl of TMEV was injected ... matter of the spinal cord from NLM mice (Fig. 3Aa and b). GFAP staining showed a lack of astrocytes in the demyelinated lesion (arrow) (Fig. 3Ac). In contrast, markedly inc...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc
... GTPcS-loaded Rac2, MgSO 4 and an optimal amount of arachidonic acid determined for each assay of oxidase activation [12]. The rate of O 2 – production by the activated NADPH oxidase was calculated ... Rac2 and S10 0A9 . Assay of NADPH oxidase activity after oxidase activation The dormant NADPH oxidase of neutrophil membranes was activated by mixing neutrophil plasma membranes and...
Ngày tải lên: 18/03/2014, 01:20
báo cáo hóa học:" Can urinary exosomes act as treatment response markers in prostate cancer?" ppt
... exosome- markers in 20 of 24 samples. There was variation across the patient cohort, and variation from within an individ- ual's sample series (ADT 4 , ADT 12 and RT 20 ). As great atten- tion was ... (RPE) stained exosome-beads, in parallel tubes; a measure of whether exosomes remain attached to the bead surface. Results are expressed as the ratio of Cal- cein: Class-I fluo...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Synthetic lethal RNAi screening identifies sensitizing targets for gemcitabine therapy in pancreatic cancer" doc
... follows: CHK1 -A, AAGAAAGAGATCTGTATCAAT; CHK1-B, TTGGAATAACTCCACGGGATA; CHK1-C, AACTGAAGAAGCAGTCGCAAGT; CHK1-D, CCCG- Journal of Translational Medicine 2009, 7:43 http://www.translational-medicine.com/content/7/1/43 Page ... the American Type Culture Collection (Manassas, VA). The MIA PaCa-2 cell line was established by Yunis, et al. in 1975 from tumor tissue of the pancreas obtained from...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Mass spectrometry-based serum proteome pattern analysis in molecular diagnostics of early stage breast cancer" pdf
... maximum values; outliers are marked by aster- isks). Estimation of the performance of classification of breast can-cer samplesFigure 1 Estimation of the performance of classification of breast cancer ... between meas- urements, which adds more complexity to analyses of large datasets. For this reason, some approaches used for analysis of large datasets relay on alignmen...
Ngày tải lên: 18/06/2014, 15:20