Báo cáo hóa học: " Characterization of age-related modifications of upper limb motor control strategies in a new dynamic environment" docx

Báo cáo hóa học: " Characterization of age-related modifications of upper limb motor control strategies in a new dynamic environment" docx

Báo cáo hóa học: " Characterization of age-related modifications of upper limb motor control strategies in a new dynamic environment" docx

... Central Page 1 of 14 (page number not for citation purposes) Journal of NeuroEngineering and Rehabilitation Open Access Research Characterization of age-related modifications of upper limb motor ... stroke, Parkinson's disease) or for traumatic brain injuries. The same approach can also be used to understand the modifications of MC strategies due to the natural...

Ngày tải lên: 19/06/2014, 08:20

14 304 0
Báo cáo hóa học: " Understanding age-related modifications of motor control strategies" doc

Báo cáo hóa học: " Understanding age-related modifications of motor control strategies" doc

... tasks increasing the reaction time to external stimuli [3]. Ageing is associated with a decrease in mental and cognitive skills and also with an important reduction in motor abilities, which are often ... redefinition of the con- trol strategies to (try to) achieve the same level of perform- ance. The analysis of the age-related modifications of motor control strate...

Ngày tải lên: 19/06/2014, 08:20

3 193 0
Báo cáo hóa học: " Characterization and Optical Properties of the Single Crystalline SnS Nanowire Arrays" pot

Báo cáo hóa học: " Characterization and Optical Properties of the Single Crystalline SnS Nanowire Arrays" pot

... HRTEM image of a single SnS Fig. 2 SEM images of AAO template and SnS nanowire arrays. a Typical SEM image of AAO template. b and c The top view in a low magnification. d SEM image of a typical cross- section Fig. ... environmental hazards. Therefore, SnS has a big potential to be used as solar absorber in a thin film solar cell and near-infrared detector [4, 5], as phot...

Ngày tải lên: 22/06/2014, 01:20

5 317 0
báo cáo hóa học: " Does angiotensin-1 converting enzyme genotype influence motor or cognitive development after pre-term birth?" docx

báo cáo hóa học: " Does angiotensin-1 converting enzyme genotype influence motor or cognitive development after pre-term birth?" docx

... 4 School of Human Development, University of Nottingham, Nottingham, UK Email: David R Harding* - david.harding@bristol.ac.uk; Sukhbir Dhamrait - s.dhamrait@ucl.ac.uk; David Devadason - daviddevadason@hotmail.com; ... Groenendaal F, van Haastert IC, Meiners LC: Correlation between the degree of periventricular leukoma- lacia diagnosed using cranial ultrasound and MRI later in infan...

Ngày tải lên: 19/06/2014, 22:20

6 242 0
báo cáo hóa học: " Dig1 protects against cell death provoked by glyphosate-based herbicides in human liver cell lines" docx

báo cáo hóa học: " Dig1 protects against cell death provoked by glyphosate-based herbicides in human liver cell lines" docx

... Enantia chlorantha, palmatine, columbamine and jatrorrhizine for thioacetamide-traumatiezd rat liver. Acta Anatomica (Basel) 1988, 131:166-170. 44. Srinivasan M, Rukkumani R, Ram Sudheer A, Menon VP: ... of 45 to 55%. They are afterwards diluted in 70% alcohol with Taraxacum officinalis mace- rate at 10 -4 , Arctium lappa at 10 -4 and Berberis vulgaris at 10 -5 . D is prepared in the m...

Ngày tải lên: 20/06/2014, 00:20

13 184 0
Báo cáo hóa học: " Respiratory syncytial virus glycoproteins uptake occurs through clathrin-mediated endocytosis in a human epithelial cell line" docx

Báo cáo hóa học: " Respiratory syncytial virus glycoproteins uptake occurs through clathrin-mediated endocytosis in a human epithelial cell line" docx

... MS: Respiratory syncytial virus (RSV) SH and G proteins are not essential for viral replication in vitro: clinical evalua- tion and molecular characterization of a cold-passaged, attenuated RSV ... this uptake pathway blocks RSV infection, demon- strating an important role of clathrin for RSV entry [9]. Proteins that are internalized through the clathrin-medi- ated pathway usually b...

Ngày tải lên: 20/06/2014, 01:20

4 231 0
Báo cáo hóa học: " Characterization of vaccinia virus A12L protein proteolysis and its participation in virus assembly" ppt

Báo cáo hóa học: " Characterization of vaccinia virus A12L protein proteolysis and its participation in virus assembly" ppt

... 153–155 into IDR, 5'-CTT CTA GGT ATC GAC TCA GTT AAT ATC GAC CGC AAG AAA CCA TCT AAA AAG ATG CCT-3'. Underlined characters indicate the mutation sites. SD1&2, SD1&3, and SD2&3 Virology ... AG /A mutation at the residues 55–57, 5'-CTT AAT TCT CAA ACA GAT GTG ACT ATC GAC ATC TGT GAT ACA AAA TCA AAG AGT TCA-3', site-directed mutation 2 (SD2) for the middle AGK...

Ngày tải lên: 20/06/2014, 01:20

12 385 0
Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

... |||||||||||||||| | || ||| AcMNPV 1484 AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT 1543 SpliNPV 64 TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG 123 ||||||||||||||||||||||||||||| ... |||||||| || ||||||| AcMNPV 1723 CGT-GTACGTAGGAAACAACAACGAATACCGCATCAGCCTGGCCAAGAAGGGCGGCGGCT 1781 SpliNPV 302 GTCCC-GTGATGAACCTGCACGCCGAATACAC-CACTTCGTTTGA-GAGTTTCATCGACA 358...

Ngày tải lên: 20/06/2014, 01:20

11 854 0
Báo cáo hóa học: " Characterization of the IFN-γ T-cell responses to immediate early antigens in humans with genital herpes" doc

Báo cáo hóa học: " Characterization of the IFN-γ T-cell responses to immediate early antigens in humans with genital herpes" doc

... response in par- ticular may be important for control of HSV[9,20,21]. The immediate early antigens are also of interest as potential vaccine antigens because they appear at the start of a rep- licative ... sensitivity and specificity needed to obtain a detailed analysis of the T-cell responses. The goal was to establish an assay that was sim- ple, reproducible, and was capabl...

Ngày tải lên: 20/06/2014, 01:20

15 329 0
Báo cáo hóa học: " Characterization of neutralizing epitopes within the major capsid protein of human papillomavirus type 33" pot

Báo cáo hóa học: " Characterization of neutralizing epitopes within the major capsid protein of human papillomavirus type 33" pot

... CCACTAGGAGTGGGAAAGTAGTTGCTGCTGGCCAGGTTGGCGGTGCTTCCTGAACCTTTAAT HPV33:HI For AATATGACTTTATGCGCCGCCATCAGCACCAGCGAGACCACCTACAAGAACAACAATTTTAAAGAATATATAAG Rev CTTATATATTCTTTAAAATTGTTGTTCTTGTAGGTGGTCTCGCTGGTGCTGATGGCGGCGCATAAAGTCATATT HPV16:BC ... ATGTTTGTAAGACACCTGTTCAACAGGGCCGGCGCCTACGGCGAGAACGTTCCCGATGACCTG Rev CAGGTCATCGGGAACGTTCTCGCCGTAGGCGCCGGCCCTGTTGAACAGGTGTCTTACAAACAT HPV33:FGb For ATTAAA...

Ngày tải lên: 20/06/2014, 02:20

11 333 0
Từ khóa:
w