Báo cáo hóa học: " Standardized voluntary force measurement in a lower extremity rehabilitation robot" ppt

Báo cáo hóa học: " Standardized voluntary force measurement in a lower extremity rehabilitation robot" ppt

Báo cáo hóa học: " Standardized voluntary force measurement in a lower extremity rehabilitation robot" ppt

... 6-minute walk test), which were assessed in the same time frame. Lokomat training sessions lasted 60 minutes and included at least 30 minutes of walking. Statistical analysis We evaluated reliability ... the sagittal plane during walking [14,15]. The hip and knee joints of the DGO are actuated by linear back-drivable actuators integrated into an exoskeleton structure. In every actuator,...
Ngày tải lên : 19/06/2014, 08:20
  • 8
  • 338
  • 0
Báo cáo hóa học: "Development and pilot testing of HEXORR: Hand EXOskeleton Rehabilitation Robot" potx

Báo cáo hóa học: "Development and pilot testing of HEXORR: Hand EXOskeleton Rehabilitation Robot" potx

... considering link- age kinematic performance (e.g. no singularities, linear coordination between driver link rotation and coupler link rotation), maximizing mechanical advantage and minimizing the range ... diagram analysis calcu- lated the torque at the drive shaft needed to statically balance this force in each linkage position. Mechanical advantage was defi ned as the output torque at t...
Ngày tải lên : 19/06/2014, 08:20
  • 16
  • 721
  • 0
báo cáo hóa học: " Effect of pioglitazone treatment in a patient with secondary multiple sclerosis" doc

báo cáo hóa học: " Effect of pioglitazone treatment in a patient with secondary multiple sclerosis" doc

... efficacy and can have adverse effects. Although immuno-modulating type- 1β interferons and glatiramer acetate reduce active CNS inflammatory lesions, clinical severity and attack fre- quency in relapsing ... with secondary MS. Case presentation: The rationale and risks of taking pioglitazone were carefully explained to the patient, consent was obtained, and treatment was initiated at 15 mg...
Ngày tải lên : 19/06/2014, 22:20
  • 4
  • 319
  • 0
Báo cáo hóa học: "Analysis of airway secretions in a model of sulfur dioxide induced chronic obstructive pulmonary disease (COPD)" potx

Báo cáo hóa học: "Analysis of airway secretions in a model of sulfur dioxide induced chronic obstructive pulmonary disease (COPD)" potx

... Positive staining indicating BrdU incorporation was only found occasionally in the surface epithelium and in glands (A, B). In contrast, AgNOR-analysis demonstrated argyrophilic nucleolar organizer ... 2005, 1:5. 30. Hara J, Fujimura M, Myou S, Oribe Y, Furusho S, Kita T, Katayama N, Abo M, Ohkura N, Herai Y, Hori A, Ishiura Y, Nobata K, Ogawa H, Yasui M, Kasahara K, Nakao S: Comparis...
Ngày tải lên : 20/06/2014, 00:20
  • 10
  • 568
  • 0
báo cáo hóa học:" Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pdf

báo cáo hóa học:" Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pdf

... TAYTTTAAAARGTGTCMAGTGT Gamma 12 CTYTTAAAAGGKGTCCAGWG Gamma 13 CYTTTAMATGGTATCCAGTGT Gamma 14 ATGGCAGCWGCYCAAAG Gamma 15 CTTTTAAAAGWTGTCCAGKGT Gamma 16 CTTCCTGATGGCAGTGGTT C region gamma primer TAACCCTTGACCAGGCATCC Key ... kappa primer TGGTGGGAAGATGGA Signal sequence/framework primers Gamma 1 GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG Gamma 2 AGGTVMAACTGCAGVAGTCWGG Gamma 3 AGGTVVAGCTGCAGVAGTCWGG Gam...
Ngày tải lên : 20/06/2014, 04:20
  • 10
  • 401
  • 0
báo cáo hóa học:" Effect of oligonucleotide primers in determining viral variability within hosts" ppt

báo cáo hóa học:" Effect of oligonucleotide primers in determining viral variability within hosts" ppt

... GG RATATGATGATGAACTGGTC 2 2-Eg2 1300–1321 2 GG GATATGATRATGAAYTGGTC 4 1-Ea 1873–1854 1 GGAGTGAAGCARTATACTGG 2 2-Ea 1873–1854 2 GGGGTGAARCARTAYACYGG 16 NS 5A 1-Ng1 6715–6739 1 TGGAYGGGGTGCGCCTACAT AGGTW ... and phylogenetic analyses; NJ and MT-P participated in molecular studies and sequence alignment, interpreted the data and helped draft the manuscript; AM interpreted data and participate...
Ngày tải lên : 20/06/2014, 04:20
  • 8
  • 231
  • 0
báo cáo hóa học:" Tuberculosis of symphysis pubis in a 17 year old male: a rare case presentation and review of literature" potx

báo cáo hóa học:" Tuberculosis of symphysis pubis in a 17 year old male: a rare case presentation and review of literature" potx

... pubic symphysis. There was no locali sed swelling and palpa- tion did not reveal any inguinal lymphadenopathy. Rec- tal examination was also normal. Laboratory tests revealed moderately increased white cell ... increased on standing and on walking. However coughing, sneezing, voiding or straining at stool did not exacerbate the symptoms. Patient also had a history low grade evening rise in...
Ngày tải lên : 20/06/2014, 04:20
  • 5
  • 385
  • 0
báo cáo hóa học:" Tuberculosis of symphysis pubis in a 17 year old male: a rare case presentation and review of literature" doc

báo cáo hóa học:" Tuberculosis of symphysis pubis in a 17 year old male: a rare case presentation and review of literature" doc

... pubic symphysis. There was no locali sed swelling and palpa- tion did not reveal any inguinal lymphadenopathy. Rec- tal examination was also normal. Laboratory tests revealed moderately increased white cell ... increased on standing and on walking. However coughing, sneezing, voiding or straining at stool did not exacerbate the symptoms. Patient also had a history low grade evening rise in...
Ngày tải lên : 20/06/2014, 07:20
  • 5
  • 353
  • 0
báo cáo hóa học:" Determinants of Treatment Access in a Population-based Cohort of HIV-positive Men and Women Living in Argentina" pdf

báo cáo hóa học:" Determinants of Treatment Access in a Population-based Cohort of HIV-positive Men and Women Living in Argentina" pdf

... emerging data on the use of highly active antiretroviral therapy (HAART) in Argentina by assessing patterns of HAART access and late vs early treatment initiation in a population-based cohort of adults ... transcriptase inhibi- tors efavirenz or nevirapine, or a ritonavir-boosted pro- tease inhibitor (indinavir, saquinavir, lopinavir, atazanavir, or fosamprenavir). Statistical Analysi...
Ngày tải lên : 20/06/2014, 08:20
  • 7
  • 398
  • 0
báo cáo hóa học:" Quality of data collection in a large HIV observational clinic database in sub-Saharan Africa: implications for clinical research and audit of care" docx

báo cáo hóa học:" Quality of data collection in a large HIV observational clinic database in sub-Saharan Africa: implications for clinical research and audit of care" docx

... this article as: Kiragga et al.: Quality of data collection in a large HIV observational clinic database in sub-Saharan Africa: implications for clinical research and audit of care. Journal of ... Uganda; 2003. 9. Kamya MR, Mayanja-Kizza H, Kambugu A, Bakeera-Kitaka S, Semitala F, Mwebaze-Songa P, Castelnuovo B, Schaefer P, Spacek LA, Gasasira AF, Katabira E, Colebunders R, Quinn TC, R...
Ngày tải lên : 20/06/2014, 08:20
  • 7
  • 455
  • 0

Xem thêm