Báo cáo hóa học: " Gait training with partial body weight support during overground walking for individuals with chronic stroke: a pilot study" ppt
Báo cáo khoa học: The outer membrane component of the multidrug efflux pump from Pseudomonas aeruginosa may be a gated channel pptx
... possibility that OprM may be a gated channel. To date, many gated channels have been reported and the calcium-activated potassium channel from rat adrenal chromaffin cells is one of them. Solaro et al. ... dialysed against a large excess of deionized water at 4 °Covernight. The liposome suspension was transferred to a glass tube, dried under an N 2 gas stream, and retained in an evacuate...
Ngày tải lên: 23/03/2014, 21:21
Báo cáo khoa học: The crystal structure of pyruvate decarboxylase from Kluyveromyces lactis Implications for the substrate activation mechanism of this enzyme ppt
... J, Sax M, Turano A & Chang CH (1982) Effects of structural variations in thiamin, its derivatives and analogues. Ann NY Acad Sci 378, 454–458. 18 Dyda F, Furey W, Swaminathan S, Sax M, Farrenkopf B ... observations. Acta Crystallogr A3 4, 517–525. 34 Vaguine AA, Richelle J & Wodak SJ (1999) sfcheck :a unified set of procedures for evaluating the quality of macromolecular structur...
Ngày tải lên: 30/03/2014, 10:20
Tài liệu Báo cáo khoa học: "Co-training for Predicting Emotions with Spoken Dialogue Data" pdf
... (HLT/NAACL). I. H. Witten and E. Frank. 2000. Data Mining: Practical Machine Learning Tools and Techniques with Java implementations. Morgan Kaufmann, San Francisco. 4 Experiments For the ... class and an upper-bound, in which the classifiers are trained on human-annotated data. Post-hoc analyses reveal that four incorrectly labeled examples were added to the training set: exam...
Ngày tải lên: 20/02/2014, 16:20
Báo cáo y học: "Changes of uterine blood flow after vaginal radical trachelectomy (VRT) in patients with early-stage uterine invasive cervical cancer"
... Toshiaki Endo 1 , Tsuyoshi Baba 1 , Yoshiaki Ezaka 1 , Kunihiko Naga- sawa 1 , Madoka Takahashi 1 , Masahito Mizuuchi 1 , Nanako Iwami 1 , Hidefumi Adachi 1 , Noriko Takeda 1 , Mit- suharu Tamagawa 2 , ... delivery was appropriate for gestational age for patient 1. Fetal growth of patient 2 was also within the normal range over the pregnancy period. Fig. 4 shows changes of cervical l...
Ngày tải lên: 25/10/2012, 11:48
Báo cáo y học: "Strength training improves muscle quality and insulin sensitivity in Hispanic older
... sample t-test comparisons for continuous and log transformed variables or Chi-square for categorical variables. Statistical Analysis Statistical analysis was based on intention-to-treat analysis ... 1RM values assessed at baseline. The coefficient of variation for repeated measures at baseline was less than 10%. Upper and lower body strength at baseline and 16 weeks was calcula...
Ngày tải lên: 31/10/2012, 15:28
Tài liệu Báo cáo khoa học: parDtoxin–antitoxin system of plasmid R1 – basic contributions, biotechnological applications and relationships with closely-related toxin–antitoxin systems ppt
... Gomez A (2004) Identificacio ´ n y cara- cterizacio ´ n de la actividad RNasa de las toxinas bacte- rianas Kid y ChpAK. PhD Thesis. Universidad Auto ´ noma de Madrid, Madrid. 57 Moyed HS & ... RNA cleavage assays performed with the 5 ¢-UUACU-3¢ and 5¢-AUACA-3¢ substrates confirmed that a substrate with flanking uracils is cleaved far more efficiently. This evaluated model provides a...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx
... K A S Q KfK aKK NK H1.2 a- pSTAAAaKAKKA RaK pSS auK aK fK aKK NaK H1.3 a- STAAPaK pTKKK RaK pSS auK aK fK a KK NaK H1.4 a- STAAPaK pTKKA RaK pSS auK aK fK aKK NaK H1.5 a- pST A E P aK pSKKK RK TSaK ... dNK H103 a- A pTAAPA AK A K A K ATK KK 2m ⁄ fK 2mK dNK H11L a- STAPAA AK A K A K AT K KK 2m ⁄ fKK dNK H11R a- A pTA – A A A aKA K A K AT K KK 2m ⁄ fKK dNK H5 a- pT p...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf
... 5¢-CG TTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CA CAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi- trogen Corporation) and reverse primers 5¢-AAGTAGGCA ACAAAACAACG-3¢ and 5¢-GTTTTCCCGACAATAA- CATGG-3¢ were used for detecting GmPDIL- 3a and GmPDIL-3b, ... DNA fragments were amplified from GmPDIL- 3a and GmPDIL- 3b cDNAs by PCR using the primers 5¢-GACGACGACA AGATGGAGGTTAAGGATGAGTTG-3¢ and 5¢-GAG GAGAA...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: "Self-Training for Biomedical Parsing" doc
... of taking an existing parser , parsing extra data and then creating a second parser by treating the extra data as further training data. Here we apply this tech- nique to parser adaptation. In partic- ular, ... of taking an existing parser, parsing extra data and then cre- ating a second parser by treating the extra data as further training data. While for many years it was thought...
Ngày tải lên: 20/02/2014, 09:20
Tài liệu Báo cáo khoa học: "Counter-Training in Discovery of Semantic Patterns" doc
... Pattern Ranking: Every pattern appearing in a relevant document is a candidate pattern. Assign a score to each candidate; the score depends on how accurately the candidate predicts the relevance ... overlap among scenarios: Management Succession and Mergers and Acquisitions are likely to have more documents in common than either has with Natural Disasters. Patterns may be pragmaticall...
Ngày tải lên: 20/02/2014, 16:20