... classified separately, and if the maximum anglicism classifier score out of all splits exceeds a target confidence c (=0.7), the orig- inal word is labeled a candidate anglicism. Parame- ter values were ... Graduate Research Grant. Julia Hockenmaier is supported by the National Sci- ence Foundation through CAREER award 1053856 and award 0803603. The authors would like to thank Dr. Marina T...
Ngày tải lên: 19/02/2014, 19:20
... ACACCC- ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified. TEHA3: ACACAGATCTCTGCAGTGAAATG- AGCTGTTGACAATTA and TEHA4: ACACCCATGGT- CTGTTTCCTGTG were used for trc amplification. The exact nucleotide sequence of each promoter region ... promoters lacUV5 and trc were amplified by PCR from vectors including the relevant genes. By using primers TEHA1: ACACAGATCTCTGCA- GGGCACCCCAGGCTTTACA and TEHA2: A...
Ngày tải lên: 06/03/2014, 01:20
Báo cáo khoa học: Differential post-translational modification of CD63 molecules during maturation of human dendritic cells potx
... multilaminar MHC class II compartments and probably only a minor part of the MHC class II molecules are secreted in exosomes. Recent data revealed an additional pathway of transport of MHC class ... isoforms of CD63 of 50 and 70 kDa, respectively. Together, these data indicate that the 70 kDa isoform of CD63 is a result of post-translational modifications of the 34 kDa...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: Alterations in the photoactivation pathway of rhodopsin mutants associated with retinitis pigmentosa potx
... II; photointermediate stability; retinal degeneration; visual diseases Correspondence P. Garriga, Departament d’Enginyeria Quı ´ mica, Universitat Polite ` cnica de Catalunya, 08222 Terrassa, Catalonia, Spain Fax: ... mutant was less stable than the active conformation of the mutant G89D and the ability to activate Gt was lower for G51V than for G89D (Table 2). Because of the stronger e...
Ngày tải lên: 22/03/2014, 16:20
Báo cáo khoa học: "What is the Minimal Set of Fragments that Achieves Maximal Parse Accuracy?" potx
... Amsterdam rens@comp.leeds.ac.uk Abstract We aim at finding the minimal set of fragments which achieves maximal parse accuracy in Data Oriented Parsing. Expe- riments with the Penn Wall Street Journal treebank show that ... LP and 89.6% LR. 5 Discussion: Converging Approaches The main goal of this paper was to find the minimal set of fragments which achieves maximal parse accuracy in Dat...
Ngày tải lên: 23/03/2014, 19:20
Báo cáo Y học: Domain organization, folding and stability of bacteriophage T4 fibritin, a segmented coiled-coil protein docx
... investigate the stability and thermodynamic properties of T4 fibritin, a set of recombinant truncated mutants was designed and analysed. All these molecules contained an intact C-terminal part and had ... with a cell (covered with Tantaloy 61 TM ) of 0.5 mL volume at a heating rate of 1 KÆmin )1 . Baseline subtraction, calcu- lation of DH cal for different peaks and determinati...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx
... noteworthy that the level of cellular activity was markedly higher with a cysteine at 35, corresponding to an increased amount of monomers; the presence of a cysteine instead of an aspartic acid at this position ... in fact sufficient for association with a PRAD, as shown by the fact that it can replace a complete AChE T or BChE T subunit in PRAD-associated tetramers, and can i...
Ngày tải lên: 30/03/2014, 13:20
Tài liệu Báo cáo khoa học: P25a ⁄ TPPP expression increases plasma membrane presentation of the dopamine transporter and enhances cellular sensitivity to dopamine toxicity pptx
... to amino acid residues 44–156, was amplified and tagged with six histidine residues by PCR using for- ward primers 5¢-CACCATCACGGAGCATCCCCTGAG- 3¢,5¢-TCGCATCACCATCACCATCACGGAGCA-3¢ and 5¢-CACCCATGGGATCGCATCACCAT-3¢, ... their analysis by SDS ⁄ PAGE. Subcellular fractionation of porcine striatal brain tissue Porcine brain cut in half in the saggital plane was obtained fresh from a local aba...
Ngày tải lên: 14/02/2014, 21:20
Báo cáo khoa học: Acidic extracellular pH increases calcium influx-triggered phospholipase D activity along with acidic sphingomyelinase activation to induce matrix metalloproteinase-9 expression in mouse metastatic melanoma pot
... Medicine, Japan 3 Department of Oral and Maxillofacial Surgery, Kanagawa Dental College, Yokosuka, Japan 4 Division of Cell Biology, Kihara Institute for Biological Research, Yokohama City University, ... 422–426. 59 Labarca C & Paigen K (1980) A simple, rapid, and sensitive DNA assay procedure. Anal Biochem 102, 344– 352. 60 Kato Y, Nagashima Y, Koshikawa N, Miyagi Y, Yasumitsu H &...
Ngày tải lên: 07/03/2014, 09:20