Báo cáo sinh học: " A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" pptx
Báo cáo sinh học: " A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" pptx
... CentralPage 1 of 6(page number not for citation purposes)Virology JournalOpen AccessShort report A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required ... suggesting that the timing and amount of I7L gene expression has importantimplications for the viral life cycle.We have previously shown through transient expressionassays that the I7L proteinase is ... inducible mutant virus. To demonstrate that the replication defect of the vtetOI7L mutant virus in the absence of TET was due to the I7L gene we tested whether viral replication could be rescued by the introduction...
- 6
- 300
- 0
báo cáo hóa học:" A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" potx
... citation purposes)Virology JournalOpen AccessShort report A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesisChelsea M ... blot with anti -I7L antisera.As expected, the I7L enzyme from the inducible mutant was detected in the core sample, as was the wild type virus (data not shown). The morphogenesis of vtetOI7L under ... the growth of this virus and rescue is optimal when the I7L gene is expressed using the authentic I7L promoter. Takentogether, these data suggest that correct temporal expression of the VV I7L...
- 6
- 208
- 0
Báo cáo sinh học: " Characterization of vaccinia virus A12L protein proteolysis and its participation in virus assembly" pptx
... GAT ACA AAATCA AAG AGT TCA-3', site-directed mutation 2 (SD2) for the middle AGK site mutation at the residues 119–121into IDR, 5'-CAG ATT GTC CAA GCT GTT ACT AAT ATCGAC CGC ATA GTT ... after the first cleavage. In consideration of the fact that the A1 2L proteolysis takes place at an N-ter-minus in advance to a C-terminal cleavage, it is more con-vincing to speculate that the A1 2L ... N-terminalend. The relatively weak intensity of 21 kDa species sug-gests that it might exist as an intermediate cleavage pep-tide rather than a final product. Taken together with the fact that a...
- 12
- 495
- 0
báo cáo sinh học:" A cross-country review of strategies of the German development cooperation to strengthen human resources" ppt
... someglobal health initiatives such as the Global Fund to FightAIDS, Tuberculosis and Malaria have started to adapt theiragenda to account for the need to strengthen HRH [3].This increase of awareness ... advantageof this bilateral agency is its representation at national anddistrict level. A message drawn from this analysis is that internationalpartners do face challenges to address HRH, but overcom-ing ... of national and international med-ical staff.Migration and reintegrationAn area where international partners and industrializedcountries may have an important role to play is in mitigat-ing...
- 8
- 428
- 0
báo cáo sinh học:" A national survey of ‘inactive’ physicians in the United States of America: enticements to reentry" potx
... acquired the data. HRR analyzed the dataand all three authors interpreted the data, wrote the manuscript, andapproved the final version.Competing interests The authors declare that they have no ... drawing for gift certificates) in January, Febru-ary and March 2008.Data were analy zed using the Statistical Package for the Social Sciences, v. 16. A chi-square statistic wasused to test for the ... AssociationWomen Physicians Congress through the Joan F. Giambalvo MemorialScholarship, to aid in data acquisition, survey printing and mailing, andstatistical data analysis. We are also grateful to Holly...
- 10
- 552
- 0
Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf
... Das et al. [2] and Gouvea et al. [6]. Mismatches are in red.TCTTGTCAAAGCAAATAATA3’5’Das primer, 9T1-1CAAGTACTCAAATCAATGATGG5’3’Gouvea primer, aBT1Target sequenceTarget sequenceCAAGTACTCAAATCAGTGATGGTTTAGTTAAGGCAAATAATABioMed ... sequenceCAAGTACTCAAATCAGTGATGGTTTAGTTAAGGCAAATAATABioMed CentralPage 1 of 5(page number not for citation purposes)Virology JournalOpen AccessResearchTyping of human rotaviruses: Nucleotide mismatches ... Breiman1, David A Sack1, Marc Van Ranst2 and Tasnim Azim1Address: 1ICDDR,B: Centre for Health and Population Research, Mohakhali, Dhaka-1212, Bangladesh and 2Laboratory of Clinical and...
- 5
- 389
- 0
Báo cáo sinh học: " Soilborne wheat mosaic virus (SBWMV) 19K protein belongs to a class of cysteine rich proteins that suppress RNA silencing" docx
... prevented RNAImmunoblot and northern analyses of the PVX infected N. benthamiana plantsFigure 3Immunoblot and northern analyses of the PVX infected N. benthamiana plants. (A) Immunoblot analysis conducted ... purposes)mixture containing 5 mM ATP, CTP, UTP, and GTP (Phar-macia-Pfizer, Mississauga, Ontario, Canada), 0.7 µl of T7polymerase (Ambion), and nuclease-free water to a finalvolume of 25 µl. The reactions ... Lys at position52 and Arg at position 54 or 55 (Lys-Xaa-Arg or Lys-Xaa-Xaa-Arg) are conserved among all except PSLV. Gly atposition 77 is conserved among all except tobraviruses. The secondary...
- 11
- 356
- 0
báo cáo sinh học:" A strategy to improve skills in pharmaceutical supply management in East Africa: the regional technical " potx
... funding Amount (USD)Assessment of ART commodity-management practices in Uganda, Kenya, Tanzania and RwandaUganda, Kenya, Tanzania, Rwanda USAID/RPM Plus Program 100 000National HIV/AIDS pharmaceutical ... the National AIDS Control Program(NACP) and the Tanzania Food and Drug Administration(TFDA). In Rwanda, the RTRC is based at the School ofPublic Health and the Department of Pharmacy in the School ... materials can be easily adapted for localuse to support ART programmes. Following the develop-ment of the materials, Kenya, Tanzania and Uganda suc-ceeded in adapting them for local use. These...
- 6
- 366
- 0
báo cáo sinh học:" A cost-effectiveness study of caesarean-section deliveries by clinical officers, general practitioners and obstetricians in Burkina Faso" doc
... our anal-ysis was that variable costs would be the same for anobstetrician-led team, a general practitioner-led team, and a clinical officer-led team. In fact, the main element of var-iable ... team was 11 757international dollars, and for a general practitioner-led team compared to a clinical officer-led teamit was 200 international dollars. Training of general practitioners appears ... of the labour. We assumed that deaths of newborns followingcaesarean sections are associated with the management ofcases by health teams at hospital level, which may notalways be the case.Finally...
- 12
- 359
- 0
báo cáo sinh học:" A review of the application and contribution of discrete choice experiments to inform human resources policy interventions" docx
... urban and rural areas in the same way, or that they value the opportunity to workin the private sector equally in rural or urban areas. Theseare strong assumptions that could be investigated ... mylene.lagarde@lshtm.ac.uk; Duane Blaauw - Duane.Blaauw@wits.ac.za* Corresponding author AbstractAlthough the factors influencing the shortage and maldistribution of health workers have been ... service in the public sectorin exchange for training received was the least importantpreference. Subgroup analyses suggested that marrieddoctors valued a job in Addis Ababa more, and that younger...
- 10
- 645
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ