Báo cáo sinh học: " A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" pptx

... Central Page 1 of 6 (page number not for citation purposes) Virology Journal Open Access Short report A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required ... suggesting that the timing and amount of I7L gene expression has important implications for the viral life cycle. We have previously shown through transien...

Ngày tải lên: 18/06/2014, 22:20

... citation purposes) Virology Journal Open Access Short report A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis Chelsea M ... blot with anti -I7L antisera. As expected, the I7L enzyme from the inducible mutant was detected in the core sample, as was the wild type virus (data not sh...

Ngày tải lên: 20/06/2014, 04:20

... GAT ACA AAA TCA AAG AGT TCA-3', site-directed mutation 2 (SD2) for the middle AGK site mutation at the residues 119–121 into IDR, 5'-CAG ATT GTC CAA GCT GTT ACT AAT ATC GAC CGC ATA GTT ... after the first cleavage. In consideration of the fact that the A1 2L proteolysis takes place at an N-ter- minus in advance to a C-terminal cleavage, it is more con- vincing to...

Ngày tải lên: 18/06/2014, 18:20

... some global health initiatives such as the Global Fund to Fight AIDS, Tuberculosis and Malaria have started to adapt their agenda to account for the need to strengthen HRH [3]. This increase of awareness ... advantage of this bilateral agency is its representation at national and district level. A message drawn from this analysis is that international partners do face challenges...

Ngày tải lên: 18/06/2014, 17:20

... acquired the data. HRR analyzed the data and all three authors interpreted the data, wrote the manuscript, and approved the final version. Competing interests The authors declare that they have no ... drawing for gift certificates) in January, Febru- ary and March 2008. Data were analy zed using the Statistical Package for the Social Sciences, v. 16. A chi-square stati...

Ngày tải lên: 18/06/2014, 17:20

... Das et al. [2] and Gouvea et al. [6]. Mismatches are in red. TCTTGTCAAAGCAAATAATA 3’ 5’ Das primer, 9T1-1 CAAGTACTCAAATCAATGATGG 5’ 3’ Gouvea primer, aBT1 Target sequence Target sequence CAAGTACTCAAATCAGTGATGG TTTAGTTAAGGCAAATAATA BioMed ... sequence CAAGTACTCAAATCAGTGATGG TTTAGTTAAGGCAAATAATA BioMed Central Page 1 of 5 (page number not for citation purposes) Virology Journal Open Access Re...

Ngày tải lên: 19/06/2014, 08:20

... prevented RNA Immunoblot and northern analyses of the PVX infected N. benthamiana plantsFigure 3 Immunoblot and northern analyses of the PVX infected N. benthamiana plants. (A) Immunoblot analysis conducted ... purposes) mixture containing 5 mM ATP, CTP, UTP, and GTP (Phar- macia-Pfizer, Mississauga, Ontario, Canada), 0.7 µl of T7 polymerase (Ambion), and nuclease-free water to a final...

Ngày tải lên: 18/06/2014, 22:20

... funding Amount (USD) Assessment of ART commodity-management practices in Uganda, Kenya, Tanzania and Rwanda Uganda, Kenya, Tanzania, Rwanda USAID/RPM Plus Program 100 000 National HIV/AIDS pharmaceutical ... the National AIDS Control Program (NACP) and the Tanzania Food and Drug Administration (TFDA). In Rwanda, the RTRC is based at the School of Public Health and the Department...

Ngày tải lên: 18/06/2014, 17:20

... our anal- ysis was that variable costs would be the same for an obstetrician-led team, a general practitioner-led team, and a clinical officer-led team. In fact, the main element of var- iable ... team was 11 757 international dollars, and for a general practitioner-led team compared to a clinical officer-led team it was 200 international dollars. Training of general practit...

Ngày tải lên: 18/06/2014, 17:20

... urban and rural areas in the same way, or that they value the opportunity to work in the private sector equally in rural or urban areas. These are strong assumptions that could be investigated ... mylene.lagarde@lshtm.ac.uk; Duane Blaauw - Duane.Blaauw@wits.ac.za * Corresponding author Abstract Although the factors influencing the shortage and maldistribution of health workers...

Ngày tải lên: 18/06/2014, 17:20