... and statistical approaches in natural language processing and has been applied to tasks such as information extraction, information retrieval and machine translation (Hockenmaier and Steedman, ... lexical and compositional, which makes its interface with syntax tr ansparent and st raightforward. This is a significant advantage for achieving robustness in natural language processing. 2 Backg...
Ngày tải lên: 23/03/2014, 18:20
... inducing death. We assessed caspase 3 and 8 activities 24 h post transfection, by caspase 3-mediated cleavage of z-MCA-VDQMDGWK(DNP)-NH 2 , and caspase 8-mediated cleavage of z-IETD-AFC, over a time ... two pathways that usually operate together and amplify each other [32, 38]. One is triggered by the activation of initiator caspases, such as caspase 10 and caspase 8, downstream of...
Ngày tải lên: 16/03/2014, 22:20
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the C-terminus ... addition to an N-terminal Nco1 cloning site. The forward o ligomer 5 ¢-TCCGAAACCAGCG GCCGCTT TATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and the reverse oligomer 5¢-GTAGGCCTT TGAA...
Ngày tải lên: 19/02/2014, 06:20
Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx
... the assay of infectivity of human adenovirus 5 DNA. Virology 52, 456–467. 41 Miyagawa E, Yoshida T, Takahashi H, Yamaguchi K, Nagano T, Kiriyama Y, Okochi K & Sato H (1999) Infection of the ... 3177–3182. 4 Okamoto H, Nishizawa T, Kato N, Ukita M, Ikeda H, Iizuka H, Miyakawa Y & Mayumi M (1998) Molecular cloning and characterization of a novel DNA virus (TTV) associated...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: "The Human Language Project: Building a Universal Corpus of the World’s Languages" pptx
... approximation to language understanding. Here is another way to put it. One measure of adequacy of a language digitization is the abil- ity of a human already fluent in a reference language—to acquire fluency ... goals for numbers of lan- guages, data per language, and coverage of lan- guage families (Whalen and Simons, 2009). Machine readability and consistency. “Cover- ing” l...
Ngày tải lên: 16/03/2014, 23:20
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc
... the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from InsP 6 using a modified ferrous sulfate ... higher specific activity k cat and V max values and lower K m value of PhyH suggests that PhyH is more catalytically efficient and has a greater affinity for InsP 6 than PhyH-DII. Substrate s...
Ngày tải lên: 14/02/2014, 15:20
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... molecular basis of enzyme thermosta- bility. J Bacteriol 185, 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car- bamoyl -a- amino acid. ... Bommarius AS, Schwarm M & Drauz K (1998) Biocatal- ysis to amino acid-based chiral pharmaceuticals - exam- ples and perspectives. J Mol Catal B-Enzym 5, 1–11. 14 Liljeblad A &...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
... senses across dictionaries, hence Wik is only used as augmented data for WMF to better learn the semantics of words. All data is tokenized, POS tagged (Toutanova et al., 2003) and lemmatized, ... threshold to elesk similarity values, which yields better performance. Same as (Sinha and Mihalcea, 2007), values of elesk larger than 240 are set to 1, and the rest are mapped to [0,1]. elesk .....
Ngày tải lên: 19/02/2014, 19:20
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... hemolymph of P. jacquemontii by affinity chromatography. It yielded a 2000-fold increase in specific activity. Analysis of the lectin on SDS/PAGE gave a single band at apparent molecular mass of 34 kDa. The ... purification. Erythrocyte preparation Blood for HA assay was prepared as described by Ravindranath et al. [12]. Hemagglutination assay Hemagglutination assays were performed in...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf
... phosphatase gene. Astandard BLAST search, with AF164795 as the query, was performed against the nonredundant databases at the NCBI site. In that way, the gene of the human phosphohistidine phosphatase ... gene. EXPERIMENTAL PROCEDURES Materials Phosphoamidate was prepared according to the method of Wei and Matthews [4]. Suc-Ala-His-Pro-Phe-pNA was purchased from Bachem AG, Switzerland....
Ngày tải lên: 21/02/2014, 01:21