Báo cáo sinh học: " Permissive human cytomegalovirus infection of a first trimester extravillous cytotrophoblast cell line" pot
Báo cáo khoa học: "Translating HPSG-style Outputs of a Robust Parser into Typed Dynamic Logic" pot
... and statistical
approaches in natural language processing and
has been applied to tasks such as information
extraction, information retrieval and machine
translation (Hockenmaier and Steedman, ... lexical and
compositional, which makes its interface with
syntax tr ansparent and st raightforward. This is
a significant advantage for achieving robustness
in natural language processing.
2 Backg...
Báo cáo khoa học: The human cytomegalovirus-encoded chemokine receptor US28 induces caspase-dependent apoptosis pptx
... inducing death. We assessed caspase 3 and 8
activities 24 h post transfection, by caspase 3-mediated
cleavage of z-MCA-VDQMDGWK(DNP)-NH
2
, and
caspase 8-mediated cleavage of z-IETD-AFC, over a
time ... two pathways that usually
operate together and amplify each other [32, 38]. One is
triggered by the activation of initiator caspases, such as
caspase 10 and caspase 8, downstream of...
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG
CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT
CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG
CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys
sequence was introduced at the C-terminus ... addition to an N-terminal Nco1 cloning site.
The forward o ligomer 5 ¢-TCCGAAACCAGCG GCCGCTT
TATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and the
reverse oligomer 5¢-GTAGGCCTT TGAA...
Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx
... the assay of infectivity of human adenovirus 5
DNA. Virology 52, 456–467.
41 Miyagawa E, Yoshida T, Takahashi H, Yamaguchi K,
Nagano T, Kiriyama Y, Okochi K & Sato H (1999)
Infection of the ... 3177–3182.
4 Okamoto H, Nishizawa T, Kato N, Ukita M, Ikeda H,
Iizuka H, Miyakawa Y & Mayumi M (1998) Molecular
cloning and characterization of a novel DNA virus
(TTV) associated...
Báo cáo khoa học: "The Human Language Project: Building a Universal Corpus of the World’s Languages" pptx
... approximation to language understanding.
Here is another way to put it. One measure of
adequacy of a language digitization is the abil-
ity of a human already fluent in a reference
language—to acquire fluency ... goals for numbers of lan-
guages, data per language, and coverage of lan-
guage families (Whalen and Simons, 2009).
Machine readability and consistency. “Cover-
ing” l...
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc
... the Bradford assay with BSA as the
standard [28].
Phytase activity assay
Phytase activity was determined by measuring the amount
of phosphate released from InsP
6
using a modified ferrous
sulfate ... higher
specific activity k
cat
and V
max
values and lower K
m
value
of PhyH suggests that PhyH is more catalytically efficient
and has a greater affinity for InsP
6
than PhyH-DII.
Substrate s...
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... molecular basis of enzyme thermosta-
bility. J Bacteriol 185, 4038–4049.
20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka
Y & Takahashi S (1997) Process for producing d-N-car-
bamoyl -a- amino acid. ... Bommarius AS, Schwarm M & Drauz K (1998) Biocatal-
ysis to amino acid-based chiral pharmaceuticals - exam-
ples and perspectives. J Mol Catal B-Enzym 5, 1–11.
14 Liljeblad A &...
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
... senses across
dictionaries, hence Wik is only used as augmented
data for WMF to better learn the semantics of words.
All data is tokenized, POS tagged (Toutanova et al.,
2003) and lemmatized, ... threshold to elesk similarity values, which yields
better performance. Same as (Sinha and Mihalcea,
2007), values of elesk larger than 240 are set to 1,
and the rest are mapped to [0,1].
elesk .....
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... hemolymph of P. jacquemontii by affinity
chromatography. It yielded a 2000-fold increase in specific
activity. Analysis of the lectin on SDS/PAGE gave a single
band at apparent molecular mass of 34 kDa.
The ... purification.
Erythrocyte preparation
Blood for HA assay was prepared as described by
Ravindranath et al. [12].
Hemagglutination assay
Hemagglutination assays were performed in...
Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf
... phosphatase gene. Astandard
BLAST
search, with AF164795 as the query, was
performed against the nonredundant databases at the NCBI site. In that way, the gene of the human phosphohistidine phosphatase ... gene.
EXPERIMENTAL PROCEDURES
Materials
Phosphoamidate was prepared according to the method of
Wei and Matthews [4]. Suc-Ala-His-Pro-Phe-pNA was
purchased from Bachem AG, Switzerland....