Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf
Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf
... 9:127 http://www.translational-medicine.com/content/9/1/127 Page 3 of 15 RESEARCH Open Access The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease Hayk Davtyan 1,2 , Anahit Ghochikyan 1 , ... Richard Cadagan 3 , Dmitriy Zamarin 3 , Irina Petrushina 2 , Nina Movsesyan 2 , Luis Martinez-Sobrido 4...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " The herpes simplex virus UL20 protein functions in glycoprotein K (gK) intracellular transport and virus-induced cell fusion are independent of UL20 functions in cytoplasmic virion envelopment" docx
... compartments, while the Table 1: Domain Mutation Name WT aa Sequence Mut. aa Sequence I CL38 YGT AGA ICL49YSRAAA I Y3 8A YGT AGT IY49AYSRASR I CL38-CL49 YGT-YSR AGA-AAA I Y3 8A- Y4 9A YGT-YSR AGT-ASR ICL61SKRSKA IV ... complementation for infectious virus production results shown in figure 2. Intracellular transport and TGN localization of UL20p mutants and gK Transport and locali...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " The Israeli strain IS-98-ST1 of West Nile virus as viral model for West Nile encephalitis in the Old World" pdf
... tropical Africa and Madagascar island) and the lineage I (tropical african strains) that caused the outbreaks of WNV infec- tion in North Africa, Europe, Israel, and in the United States. Nucleotide ... serum and a FITC-conjugated second- ary antibody, green staining) and neuronal specific enolase (using a rabbit polyclonal antiserum and an anti-rabbit polyclonal antibody m...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " The 3'''' sequences required for incorporation of an engineered ssRNA into the Reovirus genome" pot
... 150 CUA CGC CUG AAU AAG UGA UAA UAAGCGGAUGAAUGGCAGAAAUUCGGAUCCAAGAUCUC G AGACGCGAUGGUGUCAUGACCCAAGCUCAGCAG A AUCAAGUUGAAGCGUUGGCAGAUCAGACUCAACAGUUUAAGAGGACAAG C UCGAAACGUGGGCGAGAGAAGACGAUCAAUAUAAUCAGGCUCAUCCCAA C UCCACAAUGUUCCGUACGAAACCAUUUACGAAUGCGCAAU ... UAAGCGGAUGAAUGGCAGAAAUUCGGAUCCAAGAUCUC G AGACGCGAUGGUGUCAUGACCCAAGCUCAGCAG A AUCAAGUUGAAGCGUUGGCAGAUCAGACUCAACAGUUUAAGAGGACAAG C UC...
Ngày tải lên: 19/06/2014, 08:20
báo cáo sinh học:" The training and expectations of medical students in Mozambique" doc
... in Maputo, with the aim of identifying their social and geo- graphical origins and their expectations and difficulties regarding their education and professional future. Methods A piloted, standardized ... peri- ods, in April and May of 1999 (see Figure 2). All data were entered into an Access database and ana- lysed using SPSS. The statistical analysis is mostly descrip- ti...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" The double burden of human resource and HIV crises: a case study of Malawi" docx
... Government of Malawi, Ministry of Health and Population: Malawi National Health Accounts: a broader perspective of the Malawian Health Sector. 2001. 20. Government of Malawi, Ministry of Health and ... . 26. Harries AD, Hargreaves NJ, Kwanjana JH, Gausi F, Kwanjana JH, Salaniponi FM: High death rates in health care workers and teachers in Malawi, Transactions of Royal Soci...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" The health worker recruitment and deployment process in Kenya: an emergency hiring program" doc
... build leadership and management capacity at all levels; ▪ professionalizing HR departments and units and ensur- ing that HR staff have input into strategic decisions and HR innovations that will ... local labour market and patients with AIDS- related diseases can usually be discharged once they are started on ART and have been stabilized. The initial phases of the Emergency Hiri...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" The distribution and transitions of physicians in Japan: a 1974–2004 retrospective cohort study" pot
... Yasunaga - yasunagah@adm.h.u-tokyo.ac.jp; Tomoaki Imamura - imamurat@naramed-u.ac.jp * Corresponding author Abstract Background: In Japan, physicians freely choose their specialty and workplace, ... Sciences, National Institute of Public Health, Saitama, Japan, 4 Department of Health Management and Policy, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan and...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" The role of nurses and midwives in polio eradication and measles control activities: a survey in Sudan and Zambia" pdf
... and 5 World Health Organization Country Office, Lusaka, Zambia Email: Annette Mwansa Nkowane* - nkowanemwansa@who.int; Liliane Boualam - boualaml@who.int; Salah Haithami - haithamis@sud.emro.who.int; ... Nkowane* 1 , Liliane Boualam 2 , Salah Haithami 3 , El Tayeb Ahmed El Sayed 4 and Helen Mutambo 5 Address: 1 Department of Human Resources for Health, World Health Organization, Ge...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" The course of specialization in public health in Rio de Janeiro, Brazil, from 1926 to 2006: lessons and challenges Monireh Obbadi" ppt
... a consequence of various factors including re-orga- nizations of the course, availability of places, varying interest in the field of public health as a career, and the availability of scholarships. Originally, ... late 1970s, a change also occurred in the nature of the disciplines of the course. There was a gen- eral move away from biology and hygiene and towards...
Ngày tải lên: 18/06/2014, 17:20