Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx
Báo cáo y học: " WT1 PEPTIDE VACCINATION IN COMBINATION WITH IMATINIB THERAPY FOR A PATIENT WITH CML IN THE CHRONIC PHASE"
... which was a < /b> simultaneous event as increase of < /b> bcr-abl transcripts of < /b> PB cells. The < /b> asso- ciation of < /b> an increase of < /b> Treg cells and elevation of < /b> bcr-abl transcripts is < /b> not clear but it can be easily ... cytotoxicity = [(absolute number < /b> of < /b> viable target cells in < /b> the < /b> tube containing target cells only –absolu...
Ngày tải lên: 26/10/2012, 09:39
Tài liệu Báo cáo khoa học: "Discovering Global Patterns in Linguistic Networks through Spectral Analysis: A Case Study of the Consonant Inventories" pdf
... 1] . Since the < /b> first eigenvector of < /b> B is < /b> perfectly cor- 4 The < /b> role played by the < /b> top eigenvalues and eigenvectors in < /b> the < /b> spectral analysis of < /b> the < /b> adjacency matrix is < /b> compara- ble to < /b> that of < /b> the < /b> smallest ... from the < /b> analysis of < /b> the < /b> second eigen- vectors of < /b> B and...
Ngày tải lên: 22/02/2014, 02:20
Báo cáo y học: " High blood pressure, antihypertensive medication and lung function in a general adult population"
... Research and Technology and by the < /b> State of < /b> Bavaria. The < /b> work was supported by the < /b> Competence Network Asthma/COPD funded by the < /b> Federal Ministry of < /b> Education and Research (FKZ 01GI0881-0888). Author ... medication according to < /b> the < /b> recommendations of < /b> the < /b> German Hypertension Asso- ciation [20]: Antihypertensives...
Ngày tải lên: 25/10/2012, 10:45
Báo cáo y học: "High level expression of apoptosis inhibitor in hepatoma cell line expressing Hepatitis
... such as pancreatic carcinoma cells, lung cancer < /b> cells [7, 10 ], prostate cancer < /b> cells [24] and renal carcinoma cell < /b> line [28, 19, 44 ]. Other interesting finding is < /b> that the < /b> cancer < /b> cells resistant ... (Stratagene, La Jolla, CA, USA), following by PCR amplification as described in < /b> our paper [22]. The < /b> primers with the < /b> sequenc...
Ngày tải lên: 02/11/2012, 11:17
Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx
... the < /b> ligand-macromolecule reaction occured. A < /b> binding isotherm was fitted to < /b> the < /b> data, expressed in < /b> terms of < /b> the < /b> heat change per mole of < /b> ligand against the < /b> ligand to < /b> macromolecule ratio. From the < /b> binding ... of < /b> copper binding could still allow domain swapping to < /b> occur. It is < /b> of < /b> interest that...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: High activity of human butyrylcholinesterase at low pH in the presence of excess butyrylthiocholine pptx
... glutamate in < /b> cholinesterases) of < /b> the < /b> cata- lytic triad. Compression of < /b> the < /b> His-Asp/Glu diad causes the < /b> basicity of < /b> the < /b> histidine to < /b> increase, so that it is < /b> able to < /b> accept/abstract the < /b> Oc proton ... problem for any mechanism in < /b> which the < /b> catalytic histidine is < /b> the < /b> proton acceptor fo...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: High negative charge-to-size ratio in polyphosphates and heparin regulates factor VII-activating protease pdf
... polymorphism of < /b> FSAP, with reduced enzymatic activity, is < /b> a < /b> risk factor for atherosclerosis and liver fibrosis, the < /b> regulation of < /b> FSAP activity is < /b> of < /b> major importance. FSAP is < /b> activated by an auto-catalytic ... unfractionated heparin, and exhibits weak FSAP binding and activation. Mast cell-< /b> derived heparin has a < /b> hig...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khoa học: Two CYP17 genes in the South African Angora goat (Capra hircus) – the identification of three genotypes that differ in copy number and steroidogenic output pptx
... (5¢ -to3< /b> ¢) Real-time CYP17 LP (sense) CAATGATGGCATCCTGGAG Real-time CYP17 RP (antisense) GAGGCAGAGGTCACAGTAAT CYP17 sensor probe TTCTGAGCAAGGAAATTCTGTTAGAC-FL CYP17 anchor probe 640-TATTCCCTGCGCTGAAGGTGAGGA-p Real-time ... and absence of < /b> cytochrome b 5 can be attributed to < /b> the < /b> greater 17,20-lyase activity of < /b> CYP17 ACS), which results in < /b> a < /b> g...
Ngày tải lên: 07/03/2014, 06:20
Báo cáo khoa học: "High Frequency Word Entrainment in Spoken Dialogue" ppt
... their conver- sational partner. For example, in < /b> laboratory stud- ies of < /b> non-verbal entrainment (mimicry of < /b> manner- isms and facial expressions between subjects and a < /b> confederate), Chartrand and Bargh ... matching cards; in < /b> other games, they received more points if they could place objects in < /b> exactly the < /b> same location. Subjects were scor...
Ngày tải lên: 08/03/2014, 01:20
Báo cáo khoa học: High levels of structural disorder in scaffold proteins as exemplified by a novel neuronal protein, CASK-interactive protein1 pot
... result of < /b> their large size, the < /b> capacity to < /b> bind multiple partners and the < /b> lack of < /b> catalytic domains, they probably fall into the < /b> class of < /b> scaffold proteins, which bind components of < /b> a < /b> signal trans- duction ... discussed. Results Structural characterization of < /b> Caskin1 fragments As described in < /b> the < /b> introducto...
Ngày tải lên: 16/03/2014, 02:20