Báo cáo hóa học: " Development and validation of a Greek language version of the Manchester Foot Pain and Disability Index" docx

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

... B=MIC B Þ=n where A and B are the MICs of drug A and drug B in the combination, MIC A and MIC B are the MICs of drug A and drug B alone, FIC A and FIC B are the FICs of drug A and drug B and n is the number of ... purchased from Avanti Polar Lipids (Alabaster, AL, USA). FITC-Ds were purchased from Sigma. All other chemicals were reagent grade. For a...

Ngày tải lên: 16/03/2014, 00:20

18 494 0
Báo cáo khoa học: Fowlicidin-3 is an a-helical cationic host defense peptide with potent antibacterial and lipopolysaccharideneutralizing activities ppt

Báo cáo khoa học: Fowlicidin-3 is an a-helical cationic host defense peptide with potent antibacterial and lipopolysaccharideneutralizing activities ppt

... measured. Cytotoxicity assay The toxicity of fowlicidin-3 toward mammalian epithelial cells was evaluated by using MDCK cells (ATCC) and an Alamar Blue dye (Biosource, Camarillo, CA, USA) as ... pneu- moniae ATCC 13883), and Gram-positive bacteria (Listeria monocytogenes ATCC 19115, Staph. aureus ATCC 25923, Staph. aureus ATCC BAA-39, and Staph. aureus ATCC 43300) were purchased fro...

Ngày tải lên: 07/03/2014, 11:20

11 496 0
Báo cáo khoa học: Plant DNA polymerase k, a DNA repair enzyme that functions in plant meristematic and meiotic tissues docx

Báo cáo khoa học: Plant DNA polymerase k, a DNA repair enzyme that functions in plant meristematic and meiotic tissues docx

... Nagasawa, K., Kitamura, K., Yasui, A. , Nimura, Y., Ikeda, K., Hirai, M., Matsukage, A. & Nakanishi, M. (2000) Identification and characterization of human DNA polymerase b2, a DNA polymerase ... 5¢-AGCTACCATGCCT GCACGAAGAGTGCGTATTATGCCTACACTGGA GTACCGGAGCATCGTCGTGACTGGGAAAAC-3¢. [ 3 H]dTTP (10 l M ;10CiÆmmol )1 ) and enzymes were added as indicated in the figure legends, and...

Ngày tải lên: 07/03/2014, 15:20

9 492 0
Báo cáo khoa học: "Much ado about nothing: A social network model of Russian paradigmatic gaps" ppt

Báo cáo khoa học: "Much ado about nothing: A social network model of Russian paradigmatic gaps" ppt

... of Russian gaps. 2 The historical and distributional facts of Russian verbal gaps 2.1 Traditional descriptions Grammars and dictionaries of Russian frequently cite paradigmatic gaps in the ... speakers. 3 The clustering of the gaps among 2nd conjugation dental stems most likely is partially a remnant of their original causes, and partially represents analogic...

Ngày tải lên: 17/03/2014, 04:20

8 409 0
Báo cáo Y học: O-GalNAc incorporation into a cluster acceptor site of three consecutive threonines Distinct specificity of GalNAc-transferase isoforms pot

Báo cáo Y học: O-GalNAc incorporation into a cluster acceptor site of three consecutive threonines Distinct specificity of GalNAc-transferase isoforms pot

... Thr-10 and a product FITC–AAAAAAPT*TTPLK did not seem to be further modified. The ratio of FITC– T*TTPLK to FITC–PT*T*T*PLK was smaller than the ratio of FITC–AAAAAAPT*TTPLK to FITC–AAAAA APT*T*T*PLK. DISCUSSION We ... as well as negative, of GalNAc and Galb1–3GalNAc residues on the efficacy and pathway of incorporation of the second and the third GalNAc residues w...

Ngày tải lên: 17/03/2014, 10:20

11 377 0
Báo cáo khoa học: Glycolipids with nonreducing end a-mannosyl residues that have the potential to activate invariant Va19 NKT cells pptx

Báo cáo khoa học: Glycolipids with nonreducing end a-mannosyl residues that have the potential to activate invariant Va19 NKT cells pptx

... structure of the hybridomas is listed on the left. NB116 and NB202 have an amino acid variation at the CDR3 region of the invariant Va19-Ja33 a chain, whereas the others have a ‘canonical’ (germline) ... As well as a- ManCer [14] and its derivatives [18], 2,6-di -a- mannosyl phosphatidylinositol (a- Man) 2 -PtdIns, a partial structure of bacterial lipoarabinomannan...

Ngày tải lên: 30/03/2014, 08:20

12 370 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The PCR ... long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi,...

Ngày tải lên: 18/02/2014, 17:20

11 873 0
Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf

Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf

... nonterminal labels of the treebank grammar. For example, our grammar main- tains a fairly large number of semantic classes of singular nouns, and it is natural to stipulate that each of them is label-consistent ... is that it allows the grammar- ian to obtain quickly a very large 3 set of sentences that 2Actually there are 18 x 3 = 54 labels, as each label L has vari-...

Ngày tải lên: 08/03/2014, 07:20

8 563 0
Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf

Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf

... Table 1 shows a four-category data configu- 247 Development and Use of a Gold-Standard Data Set for Subjectivity Classifications Janyce M. Wiebet and Rebecca F. Bruce:[: and Thomas P. O'Harat ... a reliably annotated gold standard to support experimenting with such applications. This research is also a case study of ana- lyzing and improving manual tagging th...

Ngày tải lên: 23/03/2014, 19:20

8 354 0
Tài liệu Báo cáo khoa học: "NATURAL VS. PRECISE CONCISE LANGUAGES FOR HUMAN OPERATION OF COMPUTERS: RESEARCH ISSUES AND EXPERIMENTAL APPROACHES" doc

Tài liệu Báo cáo khoa học: "NATURAL VS. PRECISE CONCISE LANGUAGES FOR HUMAN OPERATION OF COMPUTERS: RESEARCH ISSUES AND EXPERIMENTAL APPROACHES" doc

... terminal operators prefer natural language because they are already familiar with it, and that it gives the terminal operator the great- est power and flexibility. After all , they argue, ... one-to-one/one-to-many/many-to-many relationships, set theory, boolean algebra, or predicate calculus and the proper no~atlon may he of great assis- tance in formulating queries. Ma...

Ngày tải lên: 21/02/2014, 20:20

4 364 0
w