báo cáo hóa học: "Impact of chronic Immune Thrombocytopenic Purpura (ITP) on health-related quality of life: a conceptual model starting with the patient perspective" potx

Báo cáo y học: "Impact of the Kenya post-election crisis on clinic attendance and medication adherence for HIV-infected children in western Kenya"

Báo cáo y học: "Impact of the Kenya post-election crisis on clinic attendance and medication adherence for HIV-infected children in western Kenya"

... for the AMPATH research network. He is also the Pediatrician-In- Charge for the AMPATH Pediatric HIV Care Program and the Neonatal Unit of Moi Teaching and Referral Hospital. ES is a Data Manager ... participated in the acquisition of data and qualitative analyses. He revised the manuscript critically and gave final approval for publication. ES and BM organ- ized the study...

Ngày tải lên: 25/10/2012, 10:31

10 696 0
Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"

Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"

... the study. KC was responsible for conceiving the study, data acquisition, analysis of the data, statistical analysis and drafting of the manuscript. BC was responsible for data acquisition, analysis ... in the patient charts. The study, however, was conducted four weeks after an upgrade with installation of the allergy notification, and a recent evaluation showed a...

Ngày tải lên: 25/10/2012, 10:39

9 738 1
Tài liệu Báo cáo khoa học: Impact of the native-state stability of human lysozyme variants on protein secretion by Pichia pastoris doc

Tài liệu Báo cáo khoa học: Impact of the native-state stability of human lysozyme variants on protein secretion by Pichia pastoris doc

... that the native states of all four of the mutational variants of human lysozyme that are known to be linked with disease are destabilized to a remarkably similar extent, and all have dramatically ... D67H, the F57I and W64R variants clearly populate partially folded inter- mediates upon thermal denaturation, and the values of the midpoints of thermal denaturation are s...

Ngày tải lên: 19/02/2014, 08:20

10 577 0
Báo cáo khoa học: Impact of cyclic hypoxia on HIF-1a regulation in endothelial cells – new insights for anti-tumor treatments doc

Báo cáo khoa học: Impact of cyclic hypoxia on HIF-1a regulation in endothelial cells – new insights for anti-tumor treatments doc

... the PI3K ⁄ Akt pathway and the cell respiration rate lead to an increase in HIF- 1a stabilization, thereby promoting endothelial cell survival. These effects are partly attenuated by the concomitant ... O 2 consumption) and the concomitant activation of Akt concur to support the accumulation of HIF- 1a during CyH. Of note, in the immunoblotting data corresponding to the...

Ngày tải lên: 30/03/2014, 02:20

10 522 0
Báo cáo khoa học: "Impact of Initiative on Collaborative Problem Solving ∗" docx

Báo cáo khoa học: "Impact of Initiative on Collaborative Problem Solving ∗" docx

... potentially there there is a relation be- tween these participation correlations and initiative. An analysis of initiative shows that there is a cor- relation of initiative and successful collaboration. ... characterized as a finite state ma- chine with a stack and a student model. To imple- ment the peer agent, I will replace TuTalk’s student model and add a planner mod...

Ngày tải lên: 31/03/2014, 00:20

6 397 1
 Báo cáo y học: "Relationships between free radical levels during carotid endarterectomy and markers of arteriosclerotic disease"

Báo cáo y học: "Relationships between free radical levels during carotid endarterectomy and markers of arteriosclerotic disease"

... combination of all variables analysed. Each subsequent component con- stitutes an independent linear combination of vari- ables, capturing a maximum of the variance remaining in the data set, and ... principal component analysis (PCA) was performed on the total data set. All variables were scaled to zero mean and unit variance. A detailed description of the computat...

Ngày tải lên: 26/10/2012, 10:03

7 640 0
Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"

Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"

... currently an Associate Editor of Hepatology, the official journal of the American Association for the Study of Liver Diseases (AASLD), and of Current Hepatitis Reports, and a member of the Editorial ... dynamic ranges of quantification of the currently available assays, i.e. the HCV RNA intervals within which quantification is accurate in the corresponding a...

Ngày tải lên: 02/11/2012, 09:56

6 612 0
Báo cáo y học: "Postoperative pain scores and analgesic requirements after thyroid surgery: Comparison of three intraoperative opioid regimens"

Báo cáo y học: "Postoperative pain scores and analgesic requirements after thyroid surgery: Comparison of three intraoperative opioid regimens"

... mg/kg. Tracheal intubation was performed without muscle relaxant, and anesthesia was maintained with isoflurane (end tidal 0.7-1%) and N2O/O2(50/50). Analgesia was started with a bolus fentanyl ... 0.05). Conclusion: After remifentanil based analgesia, anticipation of postoperative pain with opioid analgesic appears mandatory even for surgery rated as being moderately painful, ot...

Ngày tải lên: 02/11/2012, 10:14

3 516 1
Tài liệu Báo cáo khoa học: Secondary substrate binding strongly affects activity and binding affinity of Bacillus subtilis and Aspergillus niger GH11 xylanases docx

Tài liệu Báo cáo khoa học: Secondary substrate binding strongly affects activity and binding affinity of Bacillus subtilis and Aspergillus niger GH11 xylanases docx

... of carbohydrate- active enzymes have revealed the presence of other substrate binding regions situated on the surface of the structural unit that contains the catalytic site, rather than on an ... after subtraction of the control value (no enzyme) under the con- ditions of the assay. Activity on Azo-wheat AX An appropriate enzyme dilution and liquid Azo-wheat AX...

Ngày tải lên: 14/02/2014, 19:20

14 601 0
Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf

Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf

... 5¢-TCT ATC TCT CGA TGG ATA CAG A- 3¢; reverse, 5¢-AGG ACA GTA GAA TTA GGT CAC T-3¢). Knockdown of Hsp10 5a and Hsp105b The double-stranded RNA targeting Hsp105 (Dharmacon; 5¢-GCA AAU CAC UCA UGC AAA ... GGGTTATGTTAGCTCAGTTACAGTA pGL70()218) Sense TGTCCCCTCCAGTGAATCCCAGA Antisense GGGTTATGTTAGCTCAGTTACAGTA pGL70()194) Sense ACTCTGGAGAGTTCTGAGCAG Antisense GGGTTATGTTAGCTCAGTTACAGTA Mechan...

Ngày tải lên: 18/02/2014, 06:20

11 584 0
w