... area. This led to 14 possible combinations: (B ¼ b-Rha, A ¼ a- Rha, A ¼ a- Fuc3NAc (1fi2) a- Rha) B A, B– A B A A, B A A, B A A, B A A B A A A, B A A A, B A A A, B A A A, B A A A, B– A A A, B A A A, ... end. The following fragments were assignable (the assigned a- Rha being bold): B A B A, B A B– A, B A A A, B A A A, B A A A/ B, A A A, A A B, A A B, B A B, B A A, B A A,...
Ngày tải lên: 31/03/2014, 09:20
... VARA data were used only to capture the DAS28, the CDAI and other clinical characteristics measured at the baseline and outcome VARA visits; all other data used for the analysis were from the ... Authors’ contributions All authors made substantial contributions to conception and design, and to the analysis and interpretation of the data. TRM and GWC handled...
Ngày tải lên: 25/10/2012, 10:45
Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf
... nonterminal labels of the treebank grammar. For example, our grammar main- tains a fairly large number of semantic classes of singular nouns, and it is natural to stipulate that each of them is label-consistent ... is that it allows the grammar- ian to obtain quickly a very large 3 set of sentences that 2Actually there are 18 x 3 = 54 labels, as each label L has vari-...
Ngày tải lên: 08/03/2014, 07:20
Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf
... Table 1 shows a four-category data configu- 247 Development and Use of a Gold-Standard Data Set for Subjectivity Classifications Janyce M. Wiebet and Rebecca F. Bruce:[: and Thomas P. O'Harat ... a reliably annotated gold standard to support experimenting with such applications. This research is also a case study of ana- lyzing and improving manual tagging th...
Ngày tải lên: 23/03/2014, 19:20
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) ... Billerica, MA, USA). Initial characterization of the protein The purity and molecular mass of the protein were checked by 12% SDS ⁄ PAGE and MALDI-TOF MS....
Ngày tải lên: 18/02/2014, 14:20
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx
... tract, gills, heart and labial palp) including female gonads (oocytes), and from various stages of embryonic and larval devel- opment (blastula, gastrula, trochophore larvae, D lar- vae, 7 and ... to the amino terminal end and C2 defines the domain closest to the cell membrane. A comparison of the inferred amino acid sequence of the C1 and C2 domains reveals that...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx
... includ- ing the ERK1 ⁄ 2 pathway, the PKB pathway and the Janus kinase ⁄ signal transducer and activator of tran- scription (JAK-STAT) pathway, to promote prolifera- tion, survival and transformation ... in the Cook laboratory is funded by the Asso- ciation for International Cancer Research, Astra- Zeneca, the Babraham Institute, the Biotechnology and Biological Scienc...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: "Aspect and Discourse Structure: Is a Neutral Viewpoint Required?*" pot
... two-level theory gives an explanation for the difference between aspectual information understood as a view on a situation and temporal features of a situation. The former can be gained after applying ... the initial and finishing points of a situ- ation are indicated by I and F respectively. The duration of the situation can be drawn in two differ- ent wa...
Ngày tải lên: 17/03/2014, 09:20
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx
... these bacteria are the aetiological factor of enteric diseases but they are also associated with extraintestinal disorders, among which the most significant are neonatal meningitis and brain abscesses [1,2]. ... above for sugar analysis, and the partially methylated monosaccharides derived were conver- ted into the alditol acetates and analysed by GLC-MS. Smith degradation OPS-...
Ngày tải lên: 23/03/2014, 17:22
Báo cáo khoa học: "Compounding and derivational morphology in a finite-state setting" pptx
... addition and permutation of stems and affixes. After making sure that the re- quired affixes and stems were included in the lexicon of the grammar, we ran a comparison of exact pars- ing with the ... instance of stacking of depth 3 was observed. So, the range of phenom- ena for which the approximation is inexact is of lit- tle practical relevance. For a full...
Ngày tải lên: 23/03/2014, 19:20