báo cáo hóa học: " Change in patient concerns following total knee arthroplasty described with the International Classification of Functioning, Disability and Health: a repeated measures design" docx
Báo cáo khoa học: Change in structure of the N-terminal region of transthyretin produces change in affinity of transthyretin to T4 and T3 pdf
... TCTCGAGAAAAGAGAGGCTGAAGCTG GCCCTACGGGG AGGAGTGAATTCTCA TTCCTTGGGATTGG Sense Antisense Human ⁄ crocTTR pPIC9 1 A ACGGGCACCGGTGAATCCAAATGCC ACGGAATTCTTATTCTTGTGGATCACTG Sense Antisense 2 CTCGAGAAAAGAGAGGCTGAAGCT GGCCCAACGGGCACCGG ACGGAATTCTTATTCTTGTGGATCACTG Sense Antisense Truncated ... and cleavage by KEX2 occurs between arginine and glutamine in the sequence Glu-Lys-Arg-Glu-Ala-Glu...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: "Smaller Alignment Models for Better Translations: Unsupervised Word Alignment with the 0" potx
... after their invention, the IBM word-based translation models, widely avail- able in the GIZA++ toolkit, remain the dom- inant approach to word alignment and an in- tegral part of many statistical ... EM training as well. To test, we ran GIZA++ with the default set- ting on the smaller of our two Arabic-English datasets with the same number of iterations and found...
Ngày tải lên: 30/03/2014, 17:20
Báo cáo khoa học: "Search in the Lost Sense of “Query”: Question Formulation in Web Search Queries and its Temporal Change" pptx
... knowledge and Wikipedia (see Du- mais et al. (2002) and the references therein). Our findings call for a greater synergy between QA and IR in the web search context and an improved un- derstanding of ... 2010. Mining Query Logs: Turning Search Usage Data into Knowledge. Foundations and Trends in Information Retrieval, 4(1):1–174. Amanda Spink and H. Cenk Ozmultu. 2002....
Ngày tải lên: 17/03/2014, 00:20
Báo cáo y học: "Advances in immunomodulating therapy of HBV infection"
... conventional interferon alfa in all efficacy parameters assessed (loss of HBeAg, normalization of serum ALT) [44]. A later study of 266 predominantly Caucasian patients, showed that peginterferon alfa-2b ... combination therapy for chronic hepatitis B infection. He has a distinguished career in research of HBV reactivation after chemotherapy. He is recognized as an intern...
Ngày tải lên: 02/11/2012, 11:17
Báo cáo y học: "Advances in Molecular Diagnosis of HBV Infection and Drug Resistance"
... Central Africa; B and C predominate in Asia; D is associated with southern Europe, the Middle East, and India; E is uniquely African; and F is found in Central and South America as well as in Polynesia ... sustained response to lamivudine therapy. Hepatology 2003;38:1267-1273. Tables and Figures Table 1. Advantages and disadvantages of HBV DNA testing Advantages Di...
Ngày tải lên: 03/11/2012, 09:41
Tài liệu Báo cáo khoa học: Changes in purine specificity in tandem GAF chimeras from cyanobacterial cyaB1 adenylate cyclase and rat phosphodiesterase 2 pptx
... specifying cGMP over cAMP as a ligand [12]. Taken together the b1–b3 region of the tandem GAF domain appears to be a major determinant of purine selection. The tandem GAF domain of the Anabaena AC ... FEBS to the mammalian PDE GAF domains. cAMP is the ligand for these cyanobacterial tandem GAF domains, and cAMP binding results in stimulation of the C-terminal cat...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khóa học: Mutations in the hydrophobic core and in the protein–RNA interface affect the packing and stability of icosahedral viruses doc
... five stranded antiparallel b-sheet (strands bC–bG) facing the interior of the phage particle, with an N-terminal hairpin (strands bAandbB) and two a- helices (aAandaB) shielding most of the upper ... across the dimer interface. Each also interacts with residues on the adjacent b-strand (F) and with amino acids in the alpha-helical regions as they pass over the b-...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... [6,8,27] or to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Jap an. Recently, we reported the cloning and s equencing of the gene encoding 4-amino-3-hydroxybenzoate ... and 2-aminomuconic acid in the modified meta-cleavage path- way (Fig. 1B). The 2-aminomuconate deaminase from s train AP-3 and that from strain JS45 have b...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: "Experiments in Semantic Classification" pptx
... This approach, however, suffers from the disadvantage that there is always a danger of the headings being a priori; we can always ask whether any particular headings are the right ones, and there ... “Semantic Mes- sage Detection for Machine Translation, using an Interlin- gua,” Proceedings of the 1961 International Conference on Ma- chine Translation of Languages...
Ngày tải lên: 19/02/2014, 19:20
Tài liệu Báo cáo khoa học: Histones in functional diversification Core histone variants pdf
... variants Rama-Haritha Pusarla and Purnima Bhargava Centre for Cellular & Molecular Biology, Tarnaka, Hyderabad, India Introduction Eukaryotic cells package their DNA in the form of chromatin ... During the cell cycle, there is a spatial and temporal separation of replication and transcription. Thus variants and their modifications may regulate the timing of switchin...
Ngày tải lên: 20/02/2014, 02:22