báo cáo hóa học: " Integration of immigrants into a new cult

báo cáo hóa học: " Integration of immigrants into a new culture is related to poor sleep quality" pptx

... coordination and the statistical analysis, and helped to draft the manuscript. All authors read and approved the final manuscript. Additional material Acknowledgements This study was supported by a ... four pertaining to a monitoring and four to a blunting, i.e. distracting style of coping. Participants are asked to anticipate each scenario and rate how likely they would eng...

Ngày tải lên : 18/06/2014, 19:20

6
435
0

báo cáo hóa học:" Integration of HIV/AIDS services into African primary health care: lessons learned for health system strengthening in Mozambique a case study" pdf

... National policy mandated that par- allel pharmacies in day hospitals be phased out and tasks integrated into existing pharmacies. Provincial and district pharmacists received additional training to ... treatment. Monitoring and evaluation, laboratory, pharmacy Supervision visits for ART are now integrated and con- ducted with other programme heads. As a result of a national initiati...

Ngày tải lên : 20/06/2014, 08:20

9
400
0

báo cáo hóa học:"Packaging of actin into Ebola virus VLPs" docx

... suggests that actin may play a functional role in budding of VP40/GP VLPs. These data suggest that VP40 may interact with cellular actin, and that actin may play a role in assembly and/or budding of ... Lat -A on packaging of actin into VLPs paral- leled that of VP40 (Fig. 2B). For example, in the presence of 1.0 and 2.5 µM lat -A, slightly more actin was packaged into VP40...

Ngày tải lên : 20/06/2014, 04:20

5
285
0

Báo cáo hóa học: " Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer" ppt

... Sureban SM, Ramalingam S, Natarajan G, May R, Subramaniam D, Bishnupuri KS, Morrison AR, Dieckgraefe BK, Brackett DJ, Postier RG, et al: Translation regulatory factor RBM3 is a proto-oncogene that ... survival. Kaplan Meier analysis of recurrence free survival (A) and overall survival (B) according to RBM3 mRNA levels in Cohort I. Kaplan Meier analysis of overall survival according...

Ngày tải lên : 18/06/2014, 16:20

12
531
0

báo cáo hóa học: " Occurrence of post traumatic stress symptoms and their relationship to professional quality of life (ProQoL) in nursing staff at a forensic psychiatric security unit: a cross-sectional study" potx

... rate of PTSD symptoms at ward A. Generally, compared to normative data, mean Compas- sion Satisfaction scores (CS) were low at all the wards. At ward A; mean CS was 30.2, (SD 6.5). Ward B; mean ... explain the low compassion satisfaction scores at ward A, the admission ward. At this particular forensic unit, patients transfer to a ward with reduced security level as soon as the pa...

Ngày tải lên : 18/06/2014, 18:20

6
449
0

báo cáo hóa học: " Fear of hypoglycaemia: defining a minimum clinically important difference in patients with type 2 diabetes" docx

... therefore, had less risk of hypoglycaemia. While the response categories 'extremely dissatisfied', 'very dissatisfied', 'dissatisfied', and 'somewhat satisfied' were ... for assistance appears to be clinically meaningful to patients. This is particularly relevant because the vast majority of episodes of hypoglycaemia reported in this study...

Ngày tải lên : 18/06/2014, 19:20

8
363
0

báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot

... intellectual content. All authors commented on drafts of the manuscript and read and approved the final manuscript. Additional material Acknowledgements Grants from the Norwegian Health Association and ... living conditions and coped with diseases or impairments. Fur- ther, physical impairment can be understood as salu- togenesis (in terms of positive adaptation and resolution to stre...

Ngày tải lên : 18/06/2014, 19:20

9
844
0

Báo cáo hóa học: " Results of Clinicians Using a Therapeutic Robotic System in an Inpatient Stroke Rehabilitation Unit" potx

... system at baseline and at discharge. An occupational therapist blinded to patient allocation administered the CAHAI-7 and the CMSA at admission and discharge. At discharge, participants completed ... activ- ities of daily living was recorded. Statistical Analysis The change in ea ch outcome measure, between baseline and discharge, was statistically analyzed. Because the distribution of...

Ngày tải lên : 19/06/2014, 08:20

12
368
0

báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt

... passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855). To monitor the presence of ... Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H, Vaheri A, Plyusnin A: Isolation and characterization of Tula virus: a distinct serotype in genus Hantavirus, family Bunya- viridae. J Gen...

Ngày tải lên : 20/06/2014, 04:20

5
430
0