Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc

Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc

Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc

... follows: AURKA.FW: GAGATTTTGGGTGGTCAGTAGATG, AURKA.RW: TAGTCCAGCGTGCCACAGAGA, ESD.FW:TGTTGTC ATTGCTCCAGATACCA, ESD.RW:CCCAGCTCTCAT CTTCACCTTT, POLR2B.FW:CCTGATCATAACCAG TCCCCTAGA,OLR2B.RW:GTAAACTCCCATAGCCT GCTTACC. Melting ... 9:100 http://www.translational-medicine.com/content/9/1/100 Page 2 of 6 RESEARCH Open Access Aurora Kinase A expression is associated with lung cancer...

Ngày tải lên: 18/06/2014, 19:20

6 300 0
o cáo hóa học:" Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor " potx

o cáo hóa học:" Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor " potx

... pancreatic, ovarian, prostate and lung can- cers [3-8]. Previous data has pointed out that AURKA over -expression is associated with the carcinogenesis and/ or drug resistance in many human malignant tumors. ... 9:100 http://www.translational-medicine.com/content/9/1/100 Page 3 of 6 RESEARCH Open Access Aurora Kinase A expression is associated with lung cancer his...

Ngày tải lên: 20/06/2014, 04:20

6 312 0
Báo cáo sinh học: " Codon usage in vertebrates is associated with a low risk of acquiring nonsense mutations" doc

Báo cáo sinh học: " Codon usage in vertebrates is associated with a low risk of acquiring nonsense mutations" doc

... Flegel * Abstract Background: Codon usage in genomes is biased towards specific subsets of codons. Codon usage bias affects translational speed and accuracy, and it is associated with the tRNA levels and ... CDS analysis data. Table S4. Whole genome analysis data. Table S5. GC content and risk score ω of the 61 codons. Acknowledgements and Funding We acknowledge the discussi...

Ngày tải lên: 18/06/2014, 19:20

7 437 0
Báo cáo hóa học: " Research Article A Motion-Adaptive Deinterlacer via Hybrid Motion Detection and Edge-Pattern Recognition" docx

Báo cáo hóa học: " Research Article A Motion-Adaptive Deinterlacer via Hybrid Motion Detection and Edge-Pattern Recognition" docx

... textures is the weakness of ELA while edges defeat LA. EELA, which adaptively switches between ELA and LA, is capable of interpolating edges and textures. EPR has the same adaptive ability and is better ... “H and L” pixels is similar to delta modulation in communications systems. If the pixel value is larger than the average of pixel a, b, c,andd,itis marked as “H”andmarkeda...

Ngày tải lên: 22/06/2014, 00:20

10 310 0
Báo cáo hóa học: " Research Article A Motion-Adaptive Deinterlacer via Hybrid Motion Detection and Edge-Pattern Recognition" doc

Báo cáo hóa học: " Research Article A Motion-Adaptive Deinterlacer via Hybrid Motion Detection and Edge-Pattern Recognition" doc

... textures is the weakness of ELA while edges defeat LA. EELA, which adaptively switches between ELA and LA, is capable of interpolating edges and textures. EPR has the same adaptive ability and is better ... The motion-adaptive method with FI and LA switches between a vertical all-pass filter and a temporal all-pass filter and hence provides a content-adaptive algorithm...

Ngày tải lên: 22/06/2014, 06:20

10 282 0
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx

Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx

... min at 37 °C in 95% air and 5% CO 2 , followed by treatment with TCDD for 3 h. Then, a caspase-3 activation assay was performed for the evaluation of apoptosis. Data are presented as average values ... Recent advances in understanding the mechanisms of TCDD immunotoxicity. Int Immuno- pharmacol 2, 277–291. 2 Kamath AB, Camacho I, Nagarkatti PS & Nagarkatti M (1999) Role of Fas–Fas l...

Ngày tải lên: 23/03/2014, 13:20

13 426 0
báo cáo hóa học:" Aurora kinase inhibitors synergize with paclitaxel to induce apoptosis in ovarian cancer cells" pot

báo cáo hóa học:" Aurora kinase inhibitors synergize with paclitaxel to induce apoptosis in ovarian cancer cells" pot

... and Aurora -A kinase. (D) Low power (2×) image of ovarian tissue microarray stained for Aurora A by immunohistochemistry. (E) Aurora -A staining of TMA core of ovarian carcinoma without adjuvant ... mRNA levels of Aurora -A, TPX2, and NME-1 by quantitative real-time PCR (qPCR) (Table 2). Ovarian Cancer Tissue Microarray Analysis of Aurora -A To characterize the level of express...

Ngày tải lên: 18/06/2014, 15:20

13 475 0
báo cáo sinh học:" Development of a quality assurance handbook to improve educational courses in Africa" docx

báo cáo sinh học:" Development of a quality assurance handbook to improve educational courses in Africa" docx

... materials for the handbook and this paper, drafting the handbook and this paper, and have approved the final version of the paper. Acknowledgements We thank David Baume and Ian Willis for their helpful ... students and staff training and welfare. It has been piloted in Ghana and the feedback was incorporated into the handbook. The handbook is currently available free of charge...

Ngày tải lên: 18/06/2014, 17:20

5 488 0
báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot

báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot

... Grenadines, and Surinam in 2003; to Barbados and the Bahamas in 2004; and to Anguilla, Antigua & Bar- buda, Dominica, Grenada, and Turks & Caicos in 2005. Clinical Skills Course Data from ... are manually entered into the system at CHART headquarters in Jamaica after registration forms are mailed in, which causes a delay of Publish with Bio Med Central and every scienti...

Ngày tải lên: 18/06/2014, 17:20

8 450 0
báo cáo sinh học:" Training evaluation: a case study of training Iranian health managers" docx

báo cáo sinh học:" Training evaluation: a case study of training Iranian health managers" docx

... should incorporate new learning objectives and content in areas identified as important: practical research, job appraisal, supervision and mentorship, and organizational change management processes. The ... health, health pol- icy and systems, monitoring and evaluation and non- governmental organizations. She has worked in Asian and African community health, planning and heal...

Ngày tải lên: 18/06/2014, 17:20

14 562 0
Từ khóa:
w