Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc
Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc
... follows: AURKA.FW:
GAGATTTTGGGTGGTCAGTAGATG, AURKA.RW:
TAGTCCAGCGTGCCACAGAGA, ESD.FW:TGTTGTC
ATTGCTCCAGATACCA, ESD.RW:CCCAGCTCTCAT
CTTCACCTTT, POLR2B.FW:CCTGATCATAACCAG
TCCCCTAGA,OLR2B.RW:GTAAACTCCCATAGCCT
GCTTACC.
Melting ... 9:100
http://www.translational-medicine.com/content/9/1/100
Page 2 of 6
RESEARCH Open Access
Aurora Kinase A expression is associated with
lung cancer...
o cáo hóa học:" Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor " potx
... pancreatic, ovarian, prostate and lung can-
cers [3-8]. Previous data has pointed out that AURKA
over -expression is associated with the carcinogenesis
and/ or drug resistance in many human malignant
tumors. ... 9:100
http://www.translational-medicine.com/content/9/1/100
Page 3 of 6
RESEARCH Open Access
Aurora Kinase A expression is associated with
lung cancer his...
Báo cáo sinh học: " Codon usage in vertebrates is associated with a low risk of acquiring nonsense mutations" doc
... Flegel
*
Abstract
Background: Codon usage in genomes is biased towards specific subsets of codons. Codon usage bias affects
translational speed and accuracy, and it is associated with the tRNA levels and ... CDS analysis data.
Table S4. Whole genome analysis data. Table S5. GC content and risk
score ω of the 61 codons.
Acknowledgements and Funding
We acknowledge the discussi...
Báo cáo hóa học: " Research Article A Motion-Adaptive Deinterlacer via Hybrid Motion Detection and Edge-Pattern Recognition" docx
... textures is the weakness of ELA while
edges defeat LA. EELA, which adaptively switches between
ELA and LA, is capable of interpolating edges and textures.
EPR has the same adaptive ability and is better ... “H and L” pixels is similar to
delta modulation in communications systems. If the pixel
value is larger than the average of pixel a, b, c,andd,itis
marked as “H”andmarkeda...
Báo cáo hóa học: " Research Article A Motion-Adaptive Deinterlacer via Hybrid Motion Detection and Edge-Pattern Recognition" doc
... textures is the weakness of ELA while
edges defeat LA. EELA, which adaptively switches between
ELA and LA, is capable of interpolating edges and textures.
EPR has the same adaptive ability and is better ... The
motion-adaptive method with FI and LA switches between
a vertical all-pass filter and a temporal all-pass filter and
hence provides a content-adaptive algorithm...
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx
... min at
37 °C in 95% air and 5% CO
2
, followed by treatment with TCDD
for 3 h. Then, a caspase-3 activation assay was performed for the
evaluation of apoptosis. Data are presented as average values ... Recent advances in understanding
the mechanisms of TCDD immunotoxicity. Int Immuno-
pharmacol 2, 277–291.
2 Kamath AB, Camacho I, Nagarkatti PS & Nagarkatti
M (1999) Role of Fas–Fas l...
báo cáo hóa học:" Aurora kinase inhibitors synergize with paclitaxel to induce apoptosis in ovarian cancer cells" pot
... and Aurora -A kinase. (D) Low power (2×) image of ovarian tissue microarray stained
for Aurora A by immunohistochemistry. (E) Aurora -A staining of TMA core of ovarian carcinoma without adjuvant ... mRNA levels of Aurora -A,
TPX2, and NME-1 by quantitative real-time PCR (qPCR)
(Table 2).
Ovarian Cancer Tissue Microarray Analysis of Aurora -A
To characterize the level of express...
báo cáo sinh học:" Development of a quality assurance handbook to improve educational courses in Africa" docx
... materials for the handbook and this paper,
drafting the handbook and this paper, and have approved
the final version of the paper.
Acknowledgements
We thank David Baume and Ian Willis for their helpful ... students and staff training and welfare. It has been piloted in Ghana and the
feedback was incorporated into the handbook. The handbook is currently available free of charge...
báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot
... Grenadines, and Surinam in 2003; to Barbados
and the Bahamas in 2004; and to Anguilla, Antigua & Bar-
buda, Dominica, Grenada, and Turks & Caicos in 2005.
Clinical Skills Course
Data from ... are manually entered
into the system at CHART headquarters in Jamaica after
registration forms are mailed in, which causes a delay of
Publish with Bio Med Central and every
scienti...
báo cáo sinh học:" Training evaluation: a case study of training Iranian health managers" docx
... should incorporate new learning objectives and
content in areas identified as important: practical
research, job appraisal, supervision and mentorship, and
organizational change management processes.
The ... health, health pol-
icy and systems, monitoring and evaluation and non-
governmental organizations. She has worked in Asian and
African community health, planning and heal...
Từ khóa: