0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Hóa học - Dầu khí >

Báo cáo sinh học: " The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting" doc

Báo cáo sinh học:

Báo cáo sinh học: " The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting" doc

... 9:75http://www.translational-medicine.com/content/9/1/75Page 3 of 8REVIEW Open Access The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical settingAlessandra Maleddu1*, ... 10555].doi:10.1186/1479-5876-9-75Cite this article as: Maleddu et al.: The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting.Journal of Translational Medicine 2011 9:75.Submit ... than the others. The aim of this paper is to review the clinical significance of tyrosine kinase mutational status.Introduction Gastrointestinal stromal tumors (GIST) are rare tumors of the gastrointestinal...
  • 8
  • 517
  • 0
báo cáo sinh học:

báo cáo sinh học:" The role of regulation in influencing income-generating activities among public sector doctors in Peru" doc

... surround-ing dual practice are about medical practice generallyrather than dual practice as an isolated activity.An important aspect of regulation is its potential role in addressing the type of ... and increasing competition in this market and undermining individuals' income earning ability.Another manifestation of these pressures in this marketwas the 'exploitative' conditions ... conditionsincluding income and other aspects of the workplace asmajor concerns for individual doctors.There has been an increase in competition in the privatesector and this has created difficulties...
  • 8
  • 496
  • 0
báo cáo sinh học:

báo cáo sinh học:" The role of leadership in HRH development in challenging public health settings" potx

... Direc-torate of Human Resources put in place a national regis-tration system and created a database that details the training and background of 24 500 health workers. A semi-autonomous board was established ... Noormal's approach to achieving the gains made by the Directorate of Human Resources has been character-ized by a process of reaching consensus and developing and instilling a shared vision. Ideas and ... A national HR policy has been finalized, and work on a 10-year strategic plan has begun.Other initiatives include establishing and rehabilitatingtraining programs and institutions in Sudan (which...
  • 7
  • 571
  • 0
báo cáo sinh học:

báo cáo sinh học:" The role of pharmacists in developing countries: the current scenario in Pakistan" potx

... Masood1 and Asrul Akmal Shafie1Address: 1Social and Administrative Pharmacy, School of Pharmaceutical Sciences, Universiti Sains Malaysia, Penang, Malaysia and 2Department of Pharmacy, University ... pharmacies because of the isola-tion and lack of recognition of pharmacists as health careprofessionals. The lack of trained personnel and the resulting lack of contact of pharmacists with the ... first institution to start a pharmacy depart-ment; in 1964 a Department of Pharmacy was establishedat the University of Karachi. The pharmacy programme was initiated as a three-yearbaccalaureate...
  • 6
  • 413
  • 0
báo cáo sinh học:

báo cáo sinh học:" The role of nurses and midwives in polio eradication and measles control activities: a survey in Sudan and Zambia" pdf

... monitoring and evaluation) and the same proportion was involved in AFPsurveillance. On the other hand, in Zambia, nurses and midwives were involved in the full range of functions forSIAs and AFP ... conceptualized the project and wrote the study pro-posal, designed the questionnaires and initiated and par-ticipated in discussions, data analysis and writing of the article. LB participated in the conceptualization ... 5World Health Organization Country Office, Lusaka, ZambiaEmail: Annette Mwansa Nkowane* - nkowanemwansa@who.int; Liliane Boualam - boualaml@who.int; Salah Haithami - haithamis@sud.emro.who.int;...
  • 8
  • 628
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "The iSBTc/SITC primer on tumor immunology and biological therapy of cancer: a summary of the 2010 program" doc

... STAT1, STAT3, and STAT5 pathways. In clinical trials, IL-21 has shown promising clinical benefits among patients with melanoma and renal can-cer. IL-21 may find additional clinical applications ... first line melanoma treatment hasbeen completed and is awaiting data analysis. CTLA-4blockade has also been tested in phase II clinical trials of castrate-resistant prostate cancer and has led ... in Washington, D.C. aspart of the educational offerings associated with the society’s 25th anniversary. The target audience was basic and clinical investigators from academia, industry and regulatory...
  • 15
  • 602
  • 0
Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc

Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc

... GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGCHJ7 TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCCHJ8 CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGAHJ1 AGAAGCTCCATGTAGCAAGGCTAGHJ2 ... Bio-AATGCTACAGTATCGTCCGGTCACGTACAACATCCAGASP2 CTGGATGTTGTACGTGACCGGACGATACTGTAGCATTDU1 Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTADU2 TAGGCAGACTGACCCGGGAGCTGCTCGTACHJ5 Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTTHJ6 ... CTAGCCTTGCTAGGACATCTTCCGHJ3 CGGAAGATGTCCATCTGTTGTAGGHJ4 Bio-AAAAAACCTACAACAGATCATGGAGCTTCT5498 M. J. Dickman et al. (Eur. J. Biochem. 269) Ó FEBS 2002 The RuvABC resolvasomeQuantitative analysis...
  • 10
  • 672
  • 0
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

... 5¢-gagagatttgctttgcgggttatggatctgc-3¢; mutation K20 1A, 5¢-gttatggatctgctaccgcggctccgatcctaaacg-3¢; mutation K201F, 5¢-ggttatggatctgctacttcgctccgatcctaaacgc-3¢; and mutation M45 3A, 5¢-ggacaactttgaatgggcggagggttatattgag-3¢. ... details about the role of different resi-dues of the aglycone-binding site in the stabilization of ESà and the interdependence between the binding of aglycone and the positioning of glycone in ... delineates a channel that could be the pathway for the release of the aglycone in the glyco-sylation step and the entrance of the water moleculeinvolved in the hydrolysis of the covalent intermediate[17]....
  • 12
  • 731
  • 0
Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx

Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx

... Renata Piccoli, forcritical reading the manuscript and helpful suggestions; and to Dr Valeria Cafaro, Aurora Bracale, AntonellaAntignani and Sonia Di Gaetano for preparing some of the RNase variants ... through rotation of the RNase around its major axis (rotationangle ‘r’) and variation of the inclination (inclination angle ‘i’) withrespect to the plane of the membrane (parallel to the xy plane).Cter ... fordestabilizing and eventually permeating membranes, and that intracellular membranes play a decisive role in defining the antitumor action of an RNase.Experimental proceduresAssays with membranesSynthetic...
  • 11
  • 643
  • 0
Tài liệu Báo cáo khoa học: The role of antioxidants in the cytotoxicity of chemotherapeutic drugs pptx

Tài liệu Báo cáo khoa học: The role of antioxidants in the cytotoxicity of chemotherapeutic drugs pptx

... osmoregulation and sporulation. Isola-tion and characterization of yeast mutants blocked at various sta-ges of transport pathways are an invaluable method forunravelling the molecular details of vacuolar ... syndrome and adipocytokinesY. MatzuzawaDepartment of Internal Medicine and Molecular Science, GraduateSchool of Medicine Osaka University, Osaka, JapanVisceral fat accumulation plays crucial roles ... the generation of pre-b-HDL. Ourgoal was to characterize gene regulatory networks and ABCA1associated lipid pathways in human macrophages in cardiovascu-lar disease and under atherogenic and...
  • 7
  • 749
  • 0

Xem thêm

Từ khóa: báo cáo sinh học phân tửbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ