Báo cáo sinh học: "Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic " ppt
... stem and endothelial progenitor cells in acute renal injury: ca ira. Curr Opin Pharmacol 2006, 6(2):176-183. 12. Miyahara Y, Nagaya N, Kataoka M, Yanagawa B, Tanaka K, Hao H, Ishino K, Ishida H, ... tera- toma formation. MSC tra nsplantation has been used in clinical trials and animal models to treat musculoskeletal injuries, improve cardiac function in cardiovascular dis eas e and ameliorate...
Ngày tải lên: 18/06/2014, 19:20
... RESEARC H Open Access Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic immortalization of human ESC-derived MSCs Tian Sheng Chen 1 , Fatih Arslan 2 , ... tera- toma formation. MSC tra nsplantation has been used in clinical trials and animal models to treat musculoskeletal injuries, improve cardiac function in cardiovascular dis ea...
Ngày tải lên: 20/06/2014, 03:20
... reward rote recall of facts and don't assess a student's ability to apply knowledge in practice. The 'Teaching Guide' emphasizes structured observation as an alternative assessment ... PLWHA and how to educate patients on specific meal preparation. To support faculty with up-to-date HIV/AIDS content, the committee drafted an 'HIV/AIDS Reference Manual' that fea...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Developing a tool to measure health worker motivation in district hospitals in Kenya" pot
... represent a substantial proportion of the hos- pital (antenatal and maternal and child health clinic; gen- eral outpatient/emergency area, maternity ward and paediatric wards) and we achieved a very ... representing three latent factors, that appeared suit- able for use as a rapid tool for quantitative assessments of motivation. Qualitative data and reflection on observations made b...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt
... Return and Onward Migration among Working Age Men. In Family and Labour Studies Ottawa: Statistics Canada; 2006. 38. Takenaka A: Secondary Migration: Who Re-Migrates and Why These Migrants Matter. ... through the development of summary themes or categories from the raw data" [26]. Data management was facilitated by the use of the MaxQDA qualitative data analysis package. Results Of t...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf
... Bronchoalveolar lavage (BAL) and serum samples were obtained at days 1, 5 (acute) and 28 (long-term) post inoculation and analyzed with a multiplex assay (Beadlyte Upstate, NY) for simultaneous quantitation ... data analyses, manuscript preparation; SCB data analyses and manuscript review, and MBR per- forming experiments; JC Luminex data analysis and inter- pretation. PK and HSJ data int...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Optimisation of the use of biomass for energy production (Optimierung der energetischen Biomassenutzung) - a funding programme introduces itself" ppt
... heat, SNG (Renewable “Substitute Natural Gas”) and Renewable Hydrogen [1]. The main advantage of the AER process is a high quality product, i.e. a gas with an increased H 2 content and a ... bed material transports heat into the allothermal gasification unit where it separates additional CO 2 at temperatures less than 800°C. Residual biomass char is burnt in the second reactor...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx
... as follows: Periostin (forward, 5’ AGGCAAACAG CTCAGAGTCTTCGT 3’ and reverse, 5’ TGCAGCTTCAAGTAGGCTGAGGAA 3’ ). b-actin (forward, 5’ CTGGCACCACACCTTCTA- CAATGA 3’ and reverse, 5’ TTAATGTCACGCAC- GATTTCCCGC ... Ogawa I, Kitajima S, Kitagawa M, Kawai H, Gaffney PM, Miyauchi M, Takata T: Periostin promotes invasion and anchorage-independent growth in the metastatic process of head and neck canc...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: "Developing a theoretical relationship between electrical resistivity, temperature, and film thickness for conductors" pptx
... equivalently η) as adjustable parameters. Again, a good match between experimental and theoretical data will demonstrate that the theoretical model is reliable and valid. The parameters for the ... theoretical model that are needed to generate data (and thus compare with experimental data) are provided in Table 1. As can be seen from these data, these parameters include values for...
Ngày tải lên: 18/06/2014, 22:20
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... compilation ª 2009 FEBS TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna...
Ngày tải lên: 18/02/2014, 14:20