Báo cáo sinh học: "Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic " ppt
Báo cáo sinh học: "Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic " ppt
... stem andendothelial progenitor cells in acute renal injury: ca ira. Curr OpinPharmacol 2006, 6(2):176-183.12. Miyahara Y, Nagaya N, Kataoka M, Yanagawa B, Tanaka K, Hao H, Ishino K,Ishida H, ... tera-toma formation. MSC tra nsplantation has been used inclinical trials and animal models to treat musculoskeletalinjuries, improve cardiac function in cardiovasculardis eas e and ameliorate ... Open AccessEnabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic immortalization of human ESC-derived MSCsTian Sheng Chen1, Fatih Arslan2, Yijun Yin1,...
- 10
- 343
- 0
báo cáo hóa học:" Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic immortalization of human ESC-derived MSCs" doc
... RESEARC H Open AccessEnabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic immortalization of human ESC-derived MSCsTian Sheng Chen1, Fatih Arslan2, ... tera-toma formation. MSC tra nsplantation has been used inclinical trials and animal models to treat musculoskeletalinjuries, improve cardiac function in cardiovasculardis eas e and ameliorate ... CA, Zuba-Surma EK, Al-Mallah M, Dawn B: Adult bone marrow-derived cells for cardiac repair: a systematic review and meta-analysis. Archives of internalmedicine 2007, 167(10):989-997.5. Mazhari...
- 10
- 348
- 0
báo cáo sinh học:" Developing a competency-based curriculum in HIV for nursing schools in Haiti" pdf
... reward rote recall of facts and don't assess a student's ability to apply knowledge in practice. The'Teaching Guide' emphasizes structured observation as analternative assessment ... PLWHA andhow to educate patients on specific meal preparation.To support faculty with up-to-date HIV/AIDS content, thecommittee drafted an 'HIV/AIDS Reference Manual' thatfeatures ... Guide' places great emphasis on a mixof interactive teaching methods to stimulate active stu-dent participation, such as case-based learning, role plays,and group discussions. The 'Teaching...
- 7
- 377
- 0
báo cáo sinh học:" Developing a tool to measure health worker motivation in district hospitals in Kenya" pot
... represent a substantial proportion of the hos-pital (antenatal and maternal and child health clinic; gen-eral outpatient/emergency area, maternity ward andpaediatric wards) and we achieved a very ... representing three latent factors, that appeared suit-able for use as a rapid tool for quantitative assessments ofmotivation.Qualitative data and reflection on observations made bythe PI in ... wedeveloped an SAQ to assess motivation in hospital-basedKenyan health workers. Additionally, a comparison of thequantitative and qualitative results was made to helpunderstand the motivation score....
- 11
- 445
- 0
báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt
... Return and Onward Migration amongWorking Age Men. In Family and Labour Studies Ottawa: StatisticsCanada; 2006. 38. Takenaka A: Secondary Migration: Who Re-Migrates and WhyThese Migrants Matter. ... through thedevelopment of summary themes or categories from theraw data" [26]. Data management was facilitated by theuse of the MaxQDA qualitative data analysis package.ResultsOf the 21 nurses ... Ireland appears to haveenvisaged international recruitment campaigns as a means of importing hard-working nurses on a temporarybasis as a stop-gap solution to staffing shortages in thehealth...
- 12
- 495
- 0
Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf
... Bronchoalveolar lavage (BAL) and serum sampleswere obtained at days 1, 5 (acute) and 28 (long-term) post inoculation and analyzed with a multiplexassay (Beadlyte Upstate, NY) for simultaneous quantitation ... data analyses, manuscript preparation;SCB data analyses and manuscript review, and MBR per-forming experiments; JC Luminex data analysis and inter-pretation. PK and HSJ data interpretation; ... USA, 2Baylor Institute for Immunology and Research at Dallas, Texas, USA and 3MedImmune Inc, Gaithersburg, MD, USAEmail: Asunción Mejías - asuncion.mejias@utsouthwestern.edu; Susana Chávez-Bueno...
- 5
- 357
- 0
Báo cáo sinh học: " Optimisation of the use of biomass for energy production (Optimierung der energetischen Biomassenutzung) - a funding programme introduces itself" ppt
... heat, SNG (Renewable “Substitute Natural Gas”) and Renewable Hydrogen [1]. The main advantage of the AER process is a high quality product, i.e. a gas with an increased H2 content and a ... bed material transports heat into the allothermal gasification unit where it separates additional CO2 at temperatures less than 800°C. Residual biomass char is burnt in the second reactor ... to be evaluated according to the climate protection effects achieved. For example, these evaluations are undertaken on the basis of the biomass potential, the energy and material balance of...
- 19
- 559
- 0
Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx
... as follows: Periostin(forward, 5’ AGGCAAACAG CTCAGAGTCTTCGT 3’and reverse, 5’ TGCAGCTTCAAGTAGGCTGAGGAA3’ ). b-actin (forward, 5’ CTGGCACCACACCTTCTA-CAATGA 3’ and reverse, 5’ TTAATGTCACGCAC-GATTTCCCGC ... Ogawa I, Kitajima S, Kitagawa M, Kawai H, Gaffney PM, Miyauchi M,Takata T: Periostin promotes invasion and anchorage-independentgrowth in the metastatic process of head and neck cancer. Cancer ... Y, Ogawa I, Kitagawa M, Kitajima S, Hatano H,Tilakaratne WM, Miyauchi M, Takata T: Periostin is frequentlySun et al . Journal of Translational Medicine 2011, 9:99http://www.translational-medicine.com/content/9/1/99Page...
- 10
- 362
- 0
Báo cáo sinh học: "Developing a theoretical relationship between electrical resistivity, temperature, and film thickness for conductors" pptx
... equivalently η) as adjustable parameters. Again, a good match between experimental and theoretical data will demonstrate that the theoretical model is reliable and valid. The parameters for the ... theoretical model that are needed to generate data (and thus compare with experimental data) are provided in Table 1. As can be seen from these data, these parameters include values for c that range ... variable can be understood as a parameter that affects the material at smaller thicknesses. Materials where the value of η is closer to zero represent a fabrication and processing method that...
- 26
- 376
- 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... antisense AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... compilation ª 2009 FEBSTransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2and Mikko ... procedureThe assay was run as a three-step assay: initial incubation ofthe sample and probe, addition and incubation of the sampleand acceptor beads in the plate wells, and addition of donorbeads with...
- 9
- 457
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ