Báo cáo sinh học: "Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" doc
Báo cáo sinh học: "Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" doc
... 1312:237-242. doi:10.1186/1479-5876-9-46 Cite this article as: Xu et al.: Comparisons of three polyethyleneimine- derived nanoparticles as a gene therapy delivery system for renal cell carcinoma. Journal of Translational Medicine ... S, Kashima T, Tomita K, Kitamura T, Kodama T, Fukayama M, Aburatani H: Identification of Toll-like receptor 3 as a potential the...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" pot
... 1312:237-242. doi:10.1186/1479-5876-9-46 Cite this article as: Xu et al.: Comparisons of three polyethyleneimine- derived nanoparticles as a gene therapy delivery system for renal cell carcinoma. Journal of Translational Medicine ... S, Kashima T, Tomita K, Kitamura T, Kodama T, Fukayama M, Aburatani H: Identification of Toll-like receptor 3 as a potential the...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo sinh học: " Comparisons of the M1 genome segments and encoded µ2 proteins of different reovirus isolates" pptx
... 2304 T2S59 GCGUGA UCCGUGACAUGCGUAGUAUGACACCUGCCCCCAGGUCAAAGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304 T3C12 GCGUGA UCCGUGACAUGCGUAGUGUGACACCUGCUCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304 T3C18 ... 2304 T1L GCGUGA UCCGUGACAUGCGUAGUGUGACACCUGCCCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304 T2J GCGUGAGUCGGGUCAUGCAACGUCGAACACCUGCCCCAUGGUCAAUGGGGGUAGGGG CGGGCUAAGACUACGUAC...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity" ppt
... operator DNAs with variable affinity Tridib Ganguly, Amitava Bandhu, Partho Chattoraj, Palas K Chanda, Malabika Das, Nitai C Mandal and Subrata Sau* Address: Department of Biochemistry, Bose ... Chanda - palas2004@gmail.com; Malabika Das - malavika_das@rediffmail.com; Nitai C Mandal - mandalnc2003@yahoo.com; Subrata Sau* - sau@bic.boseinst.ernet.in * Corresponding author Abstract Backgr...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Downregulation of APOBEC3G by Xenotropic Murine Leukemia-Virus Related Virus (XMRV) in Prostate Cancer Cells docx
... given that A3 B, A3 D and A3 F have molecular weights similar to A3 G. However, the molecular weights of A3 A, A3 C and A3 H (~23 kDa) are substantially lower than A3 G and detection of A3 A /A3 C /A3 H in ... antisera raised against a C-terminal peptide representing the last 29 amino acids of human A3 G coupled to a hapten (Cat. No 10201). As a loading control β-ac...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx
... Diagnostic, Cat. No: 04688945001 TACTGCCCCACCATGACC CACGGCGTAGGAGACCAC GNRH1 #29 Roche Diagnostic, Cat. No: 04687612001 GACCTGAAAGGAGCTCTGGA CTTCTGGCCCAATGGATTTA HPRT Human HPRT Gene Assay (Roche Diagnostic, ... LightCycler computer application software 4.05 dedicated for the LightCycler 2.0. All data was analyzed using the Statistica Software ver. 6.0 (StatSoft, Poland). The Mann-Whitney...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Transmission of human hepatitis C virus from patients in secondary cells for long term culture" pot
... ttc acg cag HCV 10.2 positive cac tcg caa cca ccc tat cag HCV 1 negative act gtc ttc acg cag aag cgt cta gcc at HCV 2 negative cga gac ctc ccg ggg cac tcg caa gca ccc HCV 3 negative acg cag aaa ... supernatants was ana- lyzed quantitatively by real-time RT-PCR. As expected, on day zero there was no measurable HCV-RNA. On day one, the measurable number of copies of HCV-RNA was 3,200, whi...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo sinh học: "Use of recombinant lentivirus pseudotyped with vesicular stomatitis virus glycoprotein G for efficient generation of human anti-cancer chimeric T cells by transduction of human peripheral blood lymphocytes in vitro" pot
... 1998, 52:114-123. 34. Cabrera T, Angustias FM, Sierra A, Garrido A, Herruzo A, Escobedo A, Fabra A, Garrido F: High frequency of altered HLA class I phenotypes in invasive breast carcinomas. Hum Immunol ... sodium bicarbonate. Generation of chTCRs against CEA The chTCR against CEA was generated from: An anti-human CEA single chain antibody which was pro- vided by Hinrich Abken (Colog...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Maruyama S, Takahara M, Miyagishima SY, Mori T, Nishida K, Yagisawa F, Nishida K, Yoshida Y et al. (2004) Genome sequence of the ultrasmall unicellular red alga Cyanidioschyzon merolae 10D. Nature ... 8004–8012. 4 Enami I, Murayama H, Ohta H, Kamo M, Nakazato K & Shen J-R (1995) Isolation and characterization of a photosystem II complex from the red alga Cyanidium caldarium: associa...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo sinh học: "Including Emergency and Acute Care as a Global Health Priority" doc
... acute care was once again crowded off the agenda. The recently released UN Report of the Secretary-General on the prevention and control of NCDs [1] aggressively attacked acute care platforms ... manuscript. All authors read and approved the final manuscript. Authors’ information The International Acute Care Research Collaborative (IACRC), located within the University of M...
Ngày tải lên: 18/06/2014, 18:20