Báo cáo sinh học: "Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" docx

... study was to develop a pharmacodynamic (PD) marker assay to use in clinical development. The PD marker will determine the effect of GCP inhibitors on GCP enzymatic activity in human skin as measure ... The activity assay provides a simple and direct measurement of GCP activity from tissue samples easily assessable in human subjects. Abbreviations GCP: glutamate...

Ngày tải lên: 18/06/2014, 19:20

... rapidly developing urban areas. Specific HRH challenges have included attracting and retaining hea lth staff in remote and/or rural areas, tackling staff mal-distribution and over-specialisation, particularly ... 13 This was followed in 1981 by the introduction of the “Programa Larga Escala” which aimed at training basic and elementary health personnel, of whom 50% had no formal training,...

Ngày tải lên: 18/06/2014, 17:20

... literature in a straight arch- shaped tunnel. Then, comparisons with measurements at 5.8 GHz are performed in a curved rectangular tunnel. Finally, a statistical analysis of fast fading is performed ... 15 consists in a minimization of the path length, according to the Fermat Principle. Finally, an adaptive IMR has been developed based on the localization of reflection point...

Ngày tải lên: 18/06/2014, 22:20

... in January 2007. The Malawi team incorporated indicators for measuring scale-up into their tools, which had additional Table 2 Core HIV Indicators in Malawi and Zambia Malawi Zambia Indicator 2004 ... hospitals. Facility managers reported that workload, which had been a long-standing and worsening problem in Malawi, was being tackled in several ways, including: training and rot at...

Ngày tải lên: 18/06/2014, 17:20

... the dose-response assays for each case are depicted. a- bisabolol plus imatinib mesylate in cells bearing mutated or non-mutated BCR/ABL a- bisabolol was active against Ph + B-ALL cells (24-hour IC 50 was 46 ... marrow that was frozen in liqu id nitrogen at diagnosis [13]. In all cases frozen cell samples contained >95% blasts. Cell viability after thawing was always >90%, as...

Ngày tải lên: 18/06/2014, 19:20

... protease, and an ubiq- uitin-degrading enzyme in yeast, as well as the identity of a catalytic triad composed of histidine, cysteine, and aspartic acid, I7L has been classified as a cysteine protein- ase. ... A1 0L (P 4a) gene was amplified by polymerase chain reaction using oligonucleotides KH10 (5' CATGCCAT- GGATGATGCCTATTAAGTCAATAGTTACT CTT-3') and KH11 (5'-CCGC...

Ngày tải lên: 19/06/2014, 08:20

... concentration was measured as described by the manufacturer (Bio-Rad, Catalog # 5000112), and separate aliquots were saved at 4° C for immunoblotting and quantitative analysis as outlined below. ... Virus-induced ALI was defined as ALI caused by any viral etiology as determined by a positive rapid viral screen (direct fluorescent antibody for RSV, adenovi- rus, influenza...

Ngày tải lên: 03/11/2012, 11:48

... ♦ Learning POS tagging & Partial parsing Semantic labeling Database template fillup Mining metalinguistic activity in corpora to create lexical resources using Information Extraction ... templates in our databases. This was done by following different processing routes customized for each pattern using corpus analysis as well as FrameNet data from Name conferral a...

Ngày tải lên: 20/02/2014, 15:20

... P450c17 16-ene-synthase and 1 7a- hydroxylase/17,20-lyase activities, we performed transfection assays with increasing amounts of DNA fragments encoding cyt b 5 and monitored the formation of androstadienol and ... its activity increasing to 15% of preg transformation while the activity of human P450c17 increases to 12%. These results show that human and porcine P450c17 have similar c...

Ngày tải lên: 08/03/2014, 08:20

... the mutated gene was expressed in yeast and GC analysis revealed the presence of very long chain mono- unsaturated fatty acids (VLCMFAs), indicating that the elongase activity was restored in the ... [1- 14 C]18:1-CoA and malonyl CoA. The results of the elongase activity assays are summarized in Table 2. The elongase activity in WS-wt was low as expected, but the activity i...

Ngày tải lên: 08/03/2014, 09:20