Báo cáo sinh học: "Time-course of sFlt-1 and VEGF-A release in neutropenic patients with sepsis and septic shock: a prospective study" pptx

... sFlt-1 and VEGF -A release in neutropenic patients with sepsis and septic shock: a prospective study Brunna E Alves 1 , Silmara AL Montalvao 1 , Francisco JP Aranha 1 , Irene Lorand-Metze 2 , Carmino ... of these biomarkers obtained in a “real world” setting will be able to capture this increase in sFlt- 1and/ or VEGF -A levels of patients with a...

Ngày tải lên: 18/06/2014, 19:20

... RESEARCH Open Access Time-course of sFlt-1 and VEGF -A release in neutropenic patients with sepsis and septic shock: a prospective study Brunna E Alves 1 , Silmara AL Montalvao 1 , Francisco JP Aranha 1 , ... of these biomarkers obtained in a “real world” setting will be able to capture this increase in sFlt- 1and/ or VEGF -A levels of patients w...

Ngày tải lên: 20/06/2014, 03:20

... astrocytes remain devoid of virus. The precise variables that dictate the patterns of LCMV CNS tropism remain to be determined and are an active area of investigation within the laboratory. Another ... captured at a position approximating the midline of the cell. Statistical analyses Data handling, analysis, and graphical representations were performed using Microsoft Excel 2003...

Ngày tải lên: 18/06/2014, 18:20

... epithelia are enclosed by a basal lamina which constitutes a physical barrier against viral particles and hence a protection of the internal tissues against infection. This may explain the striking ... exclusively in the hypopharyngeal, mandibular and salivary glands, with minor accumula- tion in the crop, midgut and hind legs, while SPV had a slightly wider distribution...

Ngày tải lên: 19/06/2014, 08:20

... non-medical job in an urban area than work at a low-level health facility in a rural area [17]. Conclusion In China, primary health workers in THCs and CHCs move to high-level health facilities ... Corresponding author Abstract Background: Rural township health centres and urban community health centres play a crucial role in the delivery of primary health care in Chi...

Ngày tải lên: 18/06/2014, 17:20

... a total of 97 respondents. Data analysis Data was entered and analyzed using the Statistical Pack- age for Social Sciences (SPSS) 16.0. The quantitative data analysis included uni-variate and ... management in health care: a global context. Human Resources for Health 2006, 4:20. 4. El-Jardali F, Jamal D, Abdallah A, Kassak K: Human Resources for health planning and management...

Ngày tải lên: 18/06/2014, 17:20

... pcDNA3.1(+) vector and the myc-tag was fused to the C-terminus of RSV-F by ligating annealed primers (Sigma) mycTAAs: 5'- tcgaggaacaaaaactcatctcagaagaggatctgtaat and mycTAAa: 5'-ctagattacagatcctcttctgagatgagtttttgttcc ... cDNA was amplified by PCR (Primers (Sigma): sense: 5'-gatccaagcttccaccatggagttgccaatcctcaaa; antisense: 5'-tcgacctcgagttagttactaaatgcaatattatttatac...

Ngày tải lên: 18/06/2014, 18:20

... prefer- ential allocation of candidates raised in rural areas to training slots may sometimes act as an incentive for such candidates to return to rural areas following completion of their training, ... of trained and experienced tuberculosis health workers are poor rural and urban areas, and prisons. Data for TB prevalence in poor rural areas of most devel- oping countries...

Ngày tải lên: 18/06/2014, 17:20

... and advanced training skills, as well as the number of trainings each clinical trainer and advanced trainer had conducted since the training. Follow-Up Activities Drawing on contact information ... Barbados and the Bahamas in 2004; and to Anguilla, Antigua & Bar- buda, Dominica, Grenada, and Turks & Caicos in 2005. Clinical Skills Course Data from the telephone survey...

Ngày tải lên: 18/06/2014, 17:20

... data collection/analysis and edited this paper. FM participated in the data collection, data cleaning and preliminary analysis. CN and MM edited the paper. All authors read and approved the final ... Fifty-seven countries fall below this minimum threshold, mainly in sub-Saharan Africa and Asia. This has a major impact on infant and maternal mortality. A range of factors,...

Ngày tải lên: 18/06/2014, 17:20