báo cáo hóa học: " Quality of life in caregivers of patients with schizophrenia: A literature review" ppt
báo cáo hóa học: " Quality of life in caregivers of patients with schizophrenia: A literature review" ppt
... Central Page 1 of 5 (page number not for citation purposes) Health and Quality of Life Outcomes Open Access Review Quality of life in caregivers of patients with schizophrenia: A literature ... mem- bers. In addition, some close relatives might go away avoiding having to take care of the patient [5,16,21,37,39- 42]. Damage in caregiver social life and a...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" GJB2 mutation spectrum in 2063 Chinese patients with nonsyndromic hearing impairment" pptx
... 851 patients from central China were also ana- lyzed for mutations in Exon1 and flanking introns by PCR/sequencing. The PCR primers used are forward primer: 5'CTCATGGGGGCTCAAAGGAACTAGGAGATCGG3' and ... detected in the minorities of Xinjiang, and accounted for almost half of the GJB2 mutant alleles in minorities of Xinjiang (9 c.35delG/19 total mutant alleles). The find...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học: " Quality of life in South East Asian patients who consult for dyspepsia: Validation of the short form Nepean Dyspepsia Index" docx
... necessi- tate local cultural adaptation, translation and validation of established HRQoL instruments. In a representative South East Asian population with a significant prevalence of dyspepsia, we have ... Faculty of Medicine, University of Malaya, Kuala Lumpur, Malaysia, 2 Department of Rheumatology and Immunology, Singapore General Hospital, Singapore, 3 Department of...
Ngày tải lên: 18/06/2014, 18:20
báo cáo hóa học: "Quality of life in Brazilian obese adolescents: effects of a long-term multidisciplinary lifestyle therapy" pdf
... maralofrano@gmail.com; Hanna Karen Moreira Antunes - hannakaren@psicobio.epm.br; Wagner Luiz do Prado - wagner.prado@upe.br; Aline de Piano - aline.depiano@gmail.com; Danielle Arisa Caranti - danielle@caranti.com.br; ... patients with and without obesity. Health Qual Life Outcomes 2008, 6:11. 11. Hassan MK, Joshi AV, Madhavan SS, Amonkar MM: Obesity and health-related quality of l...
Ngày tải lên: 18/06/2014, 18:20
báo cáo hóa học: " Quality of life data as prognostic indicators of survival in cancer patients: an overview of the literature from 1982 to 2008" pot
... quality of life data or some quality of life measures and the survival duration of cancer patients. Pre-treatment (baseline) quality of life data appeared to provide the most reliable information ... The findings indicated that changes in the quality of life index, measured by a series of Linear Analog Self Assessment (LASA) scales for physical well- being, mo...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Quality of care and health-related quality of life of climacteric stage women cared for in family medicine clinics in Mexico" pot
... collaboration in designing and validating the quality of care indicators. Table 5 Relationship between health-related quality of life † and quality of care Coefficient Confidence intervals at ... article as: Doubova Dubova et al .: Quality of care and health- related quality of life of climacteric stage women cared for in family medicine clinics in Mexico. Heal...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Quality of life in chemical warfare survivors with ophthalmologic injuries: the first results form Iran Chemical Warfare Victims Health Assessment Study" potx
... collected data and all partici- pants were interviewed in their home. Data for a general Iranian population derived from a pop- ulation-based study of a random sample of the 4163 indi- viduals aged ... mustard gas is an alkylating agent that has serious, toxic effects on skin, eyes and respiratory system [2]. War has a far-reaching impact on the health and well being of the so...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Correlations among improvements in urgency urinary incontinence, health-related quality of life, and perception of bladder-related problems in incontinent subjects with overactive bladder treated with tolterodine or placebo" docx
... indicates improvement. Statistical analysis Median percentage changes in UUI episodes per week were analyzed using a rank analysis of covariance (ANCOVA) with baseline value as a covariate; mean changes ... was also demonstrated that the prevalence of OAB increases with advancing age, occurring in 20% of subjects who are ≥ 60 years of age. Antimuscarinics, such as tolterod...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " Quality of life in children three and nine months after discharge from a paediatric intensive care unit: a prospective cohort study" pdf
... Alamgir AH, Anis AH, Fitzgerald MJ, Marra CA: Evaluating health-related quality- of- life studies in paediatric populations: some conceptual, methodological and develop- mental considerations and ... PICU of the Emma Children's Hospital/Academic Medical Center Amsterdam is a tertiary PICU with 14 beds admitting patients from the greater Amsterdam area. Medical, surgi- cal a...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học: " Quality of life of Australian chronically-ill adults: patient and practice characteristics matter" doc
... General Practice, University of Adelaide, Adelaide, South Australia, Australia and 3 Faculty of Health Sciences, University of Adelaide, Adelaide, South Australia, Australia Email: Upali W Jayasinghe* ... author Abstract Background: To study health-related quality of life (HRQOL) in a large sample of Australian chronically-ill patients and investigate the impact of ch...
Ngày tải lên: 18/06/2014, 18:20