báo cáo hóa học: " Dental pain, oral impacts and perceived need for dental treatment in Tanzanian school students: a cross-sectional study" docx
... Central Page 1 of 9 (page number not for citation purposes) Health and Quality of Life Outcomes Open Access Research Dental pain, oral impacts and perceived need for dental treatment in Tanzanian ... untreated dental caries, oral impacts on daily performances and perceived need for dental care. Dental pain and reported oral problems varied sys...
Ngày tải lên: 18/06/2014, 19:20
... dental pain and dental problems. Table showing the oral impacts on daily performances by socio-demographics, dental caries, den- tal pain and dental problems. In this table a Adjusted for age, ... be a reliable and valid instrument when applied to children in numer- ous countries, such as Thailand, France, UK and Tanzania [5-8]. Untreated dental caries might l...
Ngày tải lên: 20/06/2014, 16:20
... caused by a dopamine defi- ciency in the basal ganglia that results in characteristic motor abnormalities including postural instability and gait impairment. Short shuffling steps, slow walking speed, ... walking speed, and increased stride variability characterize abnor- mal gait in PD. Although PD is primarily a motor disease, accumulating evidence suggests that abnormal propr...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học:" Synthetic lethal RNAi screening identifies sensitizing targets for gemcitabine therapy in pancreatic cancer" doc
... sequences were as follows: CHK1 -A, AAGAAAGAGATCTGTATCAAT; CHK1-B, TTGGAATAACTCCACGGGATA; CHK1-C, AACTGAAGAAGCAGTCGCAAGT; CHK1-D, CCCG- Journal of Translational Medicine 2009, 7:43 http://www.translational-medicine.com/content/7/1/43 Page ... ACGCCGTCCTTT- GAATAACAA; CHK2-B, AGGACTGTCTTATAAAGATTA; CHK2-C, CAGGATGGATTTGCCAATCTT; and CHK2-D, CTCCGTGGTTTGAACACGAAA. The sequences used in HT-R...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học: " Health-related quality of life of patients following selected types of lumbar spinal surgery: A pilot study" ppt
... healing. Symptoms: pain and mood The primary complaints of patients undergoing lumbar spinal surgery are back pain and radicular pain accompa- nied by leg weakness. The goal of spinal surgery is to ... reliabilities may be low due to a change in the patients' health after surgery as well as a three-month period between test administrations. Data analysis Data was entered into t...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học: " Comparing the SF-12 and SF-36 health status questionnaires in patients with and without obesity" pot
... study, analyzed and interpreted the data and drafted the manuscript. RD and MBH contributed to the design and interpretation of the analysis. All authors read and critically revised and approved ... response to individual items comprising that subscale; the subscales are then standardized using a z-score trans- formation and aggregated to estimate the aggregated physical and...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: "The toxicity of cadmium and resulting hazards for human health" ppt
... hyperkeratosis and acanthosis with occasional ulcerative change, and an increase of the mitotic index of the skin cells. Also cadmium concentration in blood, liver and kidney increased, thus indicating ... μg cadmium; 95% of this taken up with food and drinks. An average smoker has an additional intake of 30 μg per day [4]. Several factors can increase this amount, such as low intak...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: " Quantitative profiling of housekeeping and Epstein-Barr virus gene transcription in Burkitt lymphoma cell lines using an oligonucleotide microarray" docx
... AGGCCTTCCCGAGAAAGTGCTTAGCCTTGTTGATGATCCAAGGAACCACAT AGAGAACCAAGACGAGTGC KIAA0220 Hs.110613 70 1121 416 82.4 60.0 CS TGGAACCATCATCACCCGAACCCAAGAGGCGGAGGGTCGGTGACGTGGAA CCGTCACGCAAACCCAAGAG CLU Hs.75106 ... CS GTAGCTGCCTGCATAGGAGCCTCGCTTCCGATTATTCCCTTCCCAATATTAT TCATCCAGACTTAGCCAC KARS Hs.3100 70 1997 142 73.6 38.6 CS GCAACCACTGATACACTGGAAAGCACAACAGTTGGCACTTCTGTCTAGAAA ATAATAATTGCAAGTTGTA AAMP...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:"Special theme on HIV and disability - time for closer bonds" pdf
... dismay- ing lack of adequate efforts in this area, some positive developments have been made. As an example, at the lat- est International AIDS Conference, held in Mexico City in August 2008, several sessions ... PubMed and archived on PubMed Central yours — you keep the copyright Submit your manuscript here: http://www.biomedcentral.com/info/publishing_adv.asp BioMedcentral Journal...
Ngày tải lên: 20/06/2014, 08:20
báo cáo hóa học:" Response shift, recall bias and their effect on measuring change in health-related quality of life amongst older hospital patients" pdf
... review, appraisal and editing. Both authors read and approved the final manuscript. Author Details 1 Centre for Functioning, Disability and Health Research, Queensland Health, Buranda Plaza, Corner ... conventional change and patient perceived change adjusted for recall bias was also calculated for Table 1: Demographic information for participants included in analysis. H...
Ngày tải lên: 20/06/2014, 16:20