... Washington, USA, 3 Health Alliance International, Maputo, Mozambique and 4 Health Alliance International, Beira, Sofala, Mozambique Email: Amy Hagopian* - hagopian@u.washington.edu; Mark A Micek ... sub-Saharan Africa, the number of available health workers is so inad- equate that the model simply illustrates the gap between what the standards of care require and the supply availa- b...
Ngày tải lên: 18/06/2014, 17:20
... health challenges. Participants learned to use management and leadership tools such as the Leading and Managing Framework, gap analysis, a pri- ority matrix, the SMART Objectives Tool, an action ... a lack of leadership and management capacity at all levels as a cause of the low quality of health service delivery. They recognized that to improve health services and the health...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Training health care workers to promote HIV services for patients with tuberculosis in the Democratic Republic of Congo" pptx
... Jaques Kokolomani, National AIDS Program, for their support. The authors also thank Martine Tabala, Felicien Llenda, Richard Mangala, Willy Atungi, Lisette Kapinga, Adele Mumpassi, and Eugenie ... Karen Hawkins Reed, Mr Kashamuka Mwandagalirwa, John Ditekemene, Barbara De Coster and Ms Vera Melotte, for their support. We thank Dr Etienne Bahati, National Tuberculosis Program, and Dr Jaq...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Task shifting: the answer to the human resources crisis in Africa?" pptx
... a comprehensive and integrated reconfiguration of health teams, changed scopes of practice and regulatory frameworks and enhanced training infrastructure, as well as availability of reliable medium- to long-term ... community participation can be more than a short-term solution to address the HIV/AIDS crisis and can contribute to a revival of the primary health care approa...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Replicative phenotyping adds value to genotypic resistance testing in heavily pre-treated HIV-infected individuals - the Swiss HIV Cohort Study" doc
... [10,11]. As a spe- cial form of genotyping, virtual PRT (vPRT) correlates genotypic data for plasma HIV-1 RNA of a candidate gene with a large database of paired biological and clinical phe- notypes ... a pos- sible advantage of providing PRT remains unclear. In a randomized trial of heavily pre-treated patients PRT did notresultinanintentiontotreatanalysisinagreater propo...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo khoa học: Characterization of the glutamyl endopeptidase from Staphylococcus aureus expressed in Escherichia coli pptx
... form of GluV8 (Met1-Ala336) was amplified with a pair of primers (5¢- ATGGGATCCAAAGGTAAATTTTTAAAAGTTAGTT CT-3¢ and 5¢-ATTGGATCCCTGAATATTTATATCAGG TATATTG-3¢) and then processed as described above. T. ... (Met1-Gln282) was amplified with a pair of prim- ers: 5¢-TATGGATCCAAAAAGAGATTTTTATCTATATG TAC-3¢ and 5¢-ATTGGATCCCTGAATATTTATATCAG GTATATTG-3¢. BamHI sites introduced in the primers a...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo sinh học: "Community-acquired necrotizing pneumonia due to methicillin-sensitive Staphylococcus aureus secreting Panton-Valentine leukocidin: a review of case reports" pot
... Luna VA, Sanderson R: Fatal necrotizing pneumonia due to a Panton-Valentine leukocidin positive community-associated methicillin- sensitive Staphylococcus aureus and Influenza co-infection: a case ... Kobayashi SD, Ayeras AA, Ashraf M, Graves SF, Ragasa W, Humbird T, Greaver JL, Cantu C, Swain JL, Jenkins L, Blasdel T, Cagle PT, Gardner DJ, DeLeo FR, Musser JM: Lack of...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo toán học: " Community-acquired necrotizing pneumonia due to methicillin-sensitive Staphylococcus aureus secreting Panton-Valentine leukocidin: a review of case reports" ppt
... Luna VA, Sanderson R: Fatal necrotizing pneumonia due to a Panton-Valentine leukocidin positive community- associated methicillin-sensitive Staphylococcus aureus and Influenza co- infection: a case ... this article as: Kreienbuehl et al.: Community-acquired necrotizing pneumonia due to methicillin-sensitive Staphylococcus aureus secreting Panton-Valentin...
Ngày tải lên: 20/06/2014, 21:20