Báo cáo sinh học: " Seewis virus, a genetically distinct hantavirus in the Eurasian common shrew (Sorex araneus)" doc

... Richard Yanagihara - yanagiha@pbrc.hawaii.edu * Corresponding author Abstract More than 20 years ago, hantaviral antigens were reported in tissues of the Eurasian common shrew (Sorex araneus), Eurasian ... of hantavirus antigens in S. araneus in the former Yugoslavia and Russia [15-17]. The important distinction is that we now have sequence data to substantiate th...

Ngày tải lên: 18/06/2014, 18:20

... hantavirus, designated Seewis virus (SWSV), detected in the Eurasian common shrew. These findings add to the expanding database on soricid-associated hantaviruses and forecast that many more hantaviruses ... Richard Yanagihara - yanagiha@pbrc.hawaii.edu * Corresponding author Abstract More than 20 years ago, hantaviral antigens were reported in tissues of the Eurasian c...

Ngày tải lên: 20/06/2014, 01:20

... (4436–4455) - 5090 R TCATTCGACGCCATCTTCATT (5084–5104) - 4290 F TCACTATGATGCTGATTACTC (4282–4302) - NLV1S25F GTGAATGAAGATGGCGTCTAACGAC (1–25) + NEWRACE ATAGCAATTGTTGTCAAAGGCTGTGTAAGGGAACG (588–622) - Virology ... in Japan between 1999 and 2004 [24]. Whether or not any of these amino acids have a role in altering binding specificity would require mutational analysis of the capsid prote...

Ngày tải lên: 18/06/2014, 18:20

... TPM- M-F1 (5'-TAGTAGTAGACTCCGCA-3) and TPM-M-R3684 (5'-TAGTAGTATRCTCCGCARG-3), and HANTA-L-F2, (5'- TAGTAGTAGACTCCGGAAG-3') and HANTA-L-R6577 (5'-TAGTAGTATGCTCCGRGAA-3') ... I, Ogino M, Taruishi M, Sungdee A, Pattamadilok S, Ibrahim IN, Erlina S, Agui T, Yanagihara R, Arikawa J: Development of serological assays for Thottapalayam virus, an insectivore-borne...

Ngày tải lên: 18/06/2014, 18:20

... control. All the deglycosylated extracts were analyzed on monodimensional SDS ⁄ PAGE followed by silver nitrate and Alcian blue staining. Chitin-binding ability A chitin-binding assay was performed in ... 2129 organic lace inside which mineral nanograins (initially amorphous) self-organize, orient and crystallize in a coordinated manner. Once formed, each tablet contains this intrac...

Ngày tải lên: 22/03/2014, 16:20

... general link adaptation strategy was proposed in [10] and the system parameters including the number of data streams, number of transmit/receive antennas, use of spatial multiplexing or space time ... the large-scale fading including path loss and shadowing fading, in which d k , λ denote the distance from the BS to the user k and the path loss exponent, respectively. The...

Ngày tải lên: 18/06/2014, 22:20

... Inequalities and Applications 3.2. The Gauss Curvature of a Spacelike Surface From the Gauss equation of a spacelike surface S in M and taking in mind the expression for the Ricci tensor of M 1, Corollary ... constant mean curvature CMC spacelike graph equation in M. Note that the constraint involving the length of the gradient of u implies that the partial differe...

Ngày tải lên: 21/06/2014, 07:20

... advance, in an adaptor grammar the subtrees, as well as their probabilities, are learnt from the train- ing data. In order to make parsing and inference tractable we require the leaves of these ... epochs (passes through the training data). We scored the parses assigned to the training data at the end of sampling, and for the last two epochs we annealed at temperature 0.5...

Ngày tải lên: 20/02/2014, 09:20

... ATAAAAAAAATT- TAGCC and pA12L-reverse: 5'-CAGGATCCTTAATACAT- TCCCATATCCA GACAAC; p233-forward: 5'- ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: 5'- TTA ATACATTCCCATATCCAGACAAAATTCG. In ... sequences at the residues 55–57 (underlined), 5'- CTTAATTCTCAAACAGATGTGACTATCGACATC TGTGA- TACAAAATCAAAGAGTTCA-3'. The AG /A site-mutated A1 2L was inserted in pRB21 vecto...

Ngày tải lên: 18/06/2014, 18:20

... Universidad Autónoma, 28049 Madrid, Spain Email: Carmen E Gómez - cegomez@cnb.uam.es; Andrée Marie Vandermeeren - avanderm@cnb.uam.es; Mar a Angel Garc a - magarcia@cnb.uam.es; Elena Domingo-Gil ... (PKR) involves the alpha subunit of eukaryotic translation initiation factor 2 and NF-kappaB. Mol Cell Biol 1999, 19:4653-4663. 62. Naganuma A, Nozaki A, Tanaka T, Sugiyama K, Takagi H, Mo...

Ngày tải lên: 19/06/2014, 08:20