Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf
Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf
... took an alternative approach toexplore the relative importance and role that differentcytokines and chemokines play in acute RSV disease sever-ity.Instead of targeting individual cytokines as ... before virus inoculation. Bronchoalveolar lavage (BAL) and serum sampleswere obtained at days 1, 5 (acute) and 28 (long-term) post inoculation and analyzed with a multiplexassay (Beadlyte Upstate, ... directed against a wellconserved epitope of the RSV F protein. In summary, in the mouse model, prophylactic adminis-tration of motavizumab significantly decreased RSV repli-cation, the local and systemic...
- 5
- 357
- 0
Báo cáo hóa học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" potx
... design, data analyses, manuscript preparation;SCB data analyses and manuscript review, and MBR per-forming experiments; JC Luminex data analysis and inter-pretation. PK and HSJ data interpretation; ... citation purposes)Virology JournalOpen AccessShort report Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic ... importance and role that differentcytokines and chemokines play in acute RSV disease sever-ity.Instead of targeting individual cytokines as potential ther-apeutic targets, we took advantage...
- 5
- 562
- 0
báo cáo sinh học:" Developing a competency-based curriculum in HIV for nursing schools in Haiti" pdf
... other areas. A revision schedule has not beenset for the teaching material, as another goal of facultydevelopment will be to build their skills in maintainingtheir currency in their field and ... col-laboration between the University of Washington and University of California San Francisco and was established by the Health Resources and Services Administration(HRSA) in collaboration ... training at the pre-service level to carry out this important work.Methods: To address this issue, the Ministry of Health and Population collaborated with the InternationalTraining and Education...
- 7
- 377
- 0
báo cáo sinh học:" Developing a tool to measure health worker motivation in district hospitals in Kenya" pot
... outpatient/emergency area, maternity ward and paediatric wards) and we achieved a very high responserate (95%). Additionally, the quantitative findings were in general supported by the parallel qualitative ... that needed rephrasing. In terms of explanatory ability, our understanding of the data captured by the SAQ was supported or enhanced by qualitative data. These findings will be discussed further in ... 5:9.32. Kyaddondo D, Whyte SR: Working in a Decentralized System: A Threat to Health Workers' Respect and Survival in Uganda. International Journal of Health Planning and Management2003,...
- 11
- 445
- 0
Báo cáo sinh học: " Polymerase activity of hybrid ribonucleoprotein complexes generated from reassortment between 2009 pandemic H1N1 and seasonal H3N2 influenza A viruses" ppt
... Oxford). The pandemic H1N1 viral RNA (A/ Auckland/1/2009) was kindly provided by Ian G Barr, World Health Organization Collaborating Centre for Reference and Research on Influenza, Australia. The ... Brownlee GG: Amino acid residues in the N-terminal region of the PA subunit of influenza A virus RNA polymerase play a critical role in protein stability, endonuclease activity, cap binding, and virion ... that a new influenza virus was found in Mexico and the United States [1]. The new influenza A H1N1 virus was soon characterized [2,3] to be a triple reassortant derived from human, avian and...
- 15
- 237
- 0
Báo cáo sinh học: "Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic " ppt
... acute renal injury: ca ira. Curr OpinPharmacol 2006, 6(2):176-183.12. Miyahara Y, Nagaya N, Kataoka M, Yanagawa B, Tanaka K, Hao H, Ishino K,Ishida H, Shimizu T, Kangawa K, et al: Monolayered mesenchymal ... signaling2007,2:9.35. Thomas PD, Campbell MJ, Kejariwal A, Mi H, Karlak B, Daverman R,Diemer K, Muruganujan A, Narechania A: PANTHER: a library of proteinfamilies and subfamilies indexed by ... isolated by HPLC fractionation and tested in a mouse model of myocardial ischemia/reperfusion injury, and infarct sizes werefurther assessed by using Evans’ blue dye injection and TTC staining.Results:...
- 10
- 343
- 0
Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx
... (Shanghai) and presented as follows: Periostin(forward, 5’ AGGCAAACAG CTCAGAGTCTTCGT 3’ and reverse, 5’ TGCAGCTTCAAGTAGGCTGAGGAA3’ ). b-actin (forward, 5’ CTGGCACCACACCTTCTA-CAATGA 3’ and ... Immunohistochemicalstaining of periostin in PCa and BPH. Negative epithelial and stromalperiostin expression in BPH (a) and PCa(c). Positive epithelial and stromalperiostin expression in BPH(b) and PCa(d). B: The ... Ogawa I, Kitajima S, Kitagawa M, Kawai H, Gaffney PM, Miyauchi M,Takata T: Periostin promotes invasion and anchorage-independentgrowth in the metastatic process of head and neck cancer. Cancer...
- 10
- 362
- 0
Báo cáo sinh học: "Developing a theoretical relationship between electrical resistivity, temperature, and film thickness for conductors" pptx
... equivalently η) as adjustable parameters. Again, a good match between experimental and theoretical data will demonstrate that the theoretical model is reliable and valid. The parameters for the theoretical ... with the bulk values, to reflect the change in the response of the atoms when the material has dimensions on the nanoscale. By adjusting the value of γ in the model and making them a little ... these papers either make assumptions which reduce the complexity (and make the equation easier to analyze), and as a result, the accuracy decreases, or these papers introduce additional variables...
- 26
- 376
- 0
Báo cáo sinh học: " Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA" doc
... r01-267601-268901-2690Raccoon (Mi chigan, USA) A7 5/17Dog (Co lorado, USA)JavelinaRaccoon dogT anu(Japan)Dog (Taiwan)Dog Hamam (Japan)Dog KDK1 (Japan)Dog Ueno (Japan)G iant panda (C hina)Dog Yanaka (Japan)Dog ... species at the zoo that had been vaccinated. For this reason, use ofthat particular vaccine was discontinued; instead,Purevax™, a recombinant CDV-canary pox virus vaccine(Merial, Duluth, GA) is ... Yoshikawa Y, Ochikubo F, Matsubara Y, Tsuruoka H, Ishii M, ShirotaK, Nomura Y, Sugiyama M, Yamanouchi K: Natural infection withcanine distemper virus in a Japanese monkey (Macacafuscata). Veterinary...
- 14
- 346
- 0
Báo cáo sinh học: " Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pptx
... mosaic virus (EACMV),East African cassava mosaic Cameroon virus (EACMCV), EastAfrican cassava mosaic Malawi virus (EACMMV), East Afri-can cassava mosaic Zanzibar virus (EACMZV) and SouthAfrican ... (CMD)cassava mosaic geminiviruses (CMGs)African cassava mosaic virus (ACMV)East African cassava mosaic virus (EACMV)East African cassava mosaic Cameroon virus (EACMCV)geminivirus recombinationvirus evolution.AbstractCassava ... geminiviruses from Tanzania and other geminiviruses from Africa and the Indian sub-continent. Values above 89% are in bold and names of isolates from Tanzania are in bold. Virus Isolate ACMV-[TZ]EACMCV-[TZ1]EACMCV-[TZ7]EACMV-[KE/TZT]EACMV-[KE/TZM]EACMV-[TZ/YV]EACMV-UG2...
- 23
- 612
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM