Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf
Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf
... took an alternative approach to explore the relative importance and role that different cytokines and chemokines play in acute RSV disease sever- ity. Instead of targeting individual cytokines as ... before virus inoculation. Bronchoalveolar lavage (BAL) and serum samples were obtained at days 1, 5 (acute) and 28 (long-term) post inoculation and analyzed with a multiplex a...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" potx
... design, data analyses, manuscript preparation; SCB data analyses and manuscript review, and MBR per- forming experiments; JC Luminex data analysis and inter- pretation. PK and HSJ data interpretation; ... citation purposes) Virology Journal Open Access Short report Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly...
Ngày tải lên: 20/06/2014, 01:20
báo cáo sinh học:" Developing a competency-based curriculum in HIV for nursing schools in Haiti" pdf
... other areas. A revision schedule has not been set for the teaching material, as another goal of faculty development will be to build their skills in maintaining their currency in their field and ... col- laboration between the University of Washington and University of California San Francisco and was established by the Health Resources and Services Administration (HRSA)...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Developing a tool to measure health worker motivation in district hospitals in Kenya" pot
... outpatient/emergency area, maternity ward and paediatric wards) and we achieved a very high response rate (95%). Additionally, the quantitative findings were in general supported by the parallel qualitative ... that needed rephrasing. In terms of explanatory ability, our understanding of the data captured by the SAQ was supported or enhanced by qualitative data. These...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Polymerase activity of hybrid ribonucleoprotein complexes generated from reassortment between 2009 pandemic H1N1 and seasonal H3N2 influenza A viruses" ppt
... Oxford). The pandemic H1N1 viral RNA (A/ Auckland/1/2009) was kindly provided by Ian G Barr, World Health Organization Collaborating Centre for Reference and Research on Influenza, Australia. The ... Brownlee GG: Amino acid residues in the N-terminal region of the PA subunit of influenza A virus RNA polymerase play a critical role in protein stability, endonuclease a...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic " ppt
... acute renal injury: ca ira. Curr Opin Pharmacol 2006, 6(2):176-183. 12. Miyahara Y, Nagaya N, Kataoka M, Yanagawa B, Tanaka K, Hao H, Ishino K, Ishida H, Shimizu T, Kangawa K, et al: Monolayered mesenchymal ... signaling 2007, 2:9. 35. Thomas PD, Campbell MJ, Kejariwal A, Mi H, Karlak B, Daverman R, Diemer K, Muruganujan A, Narechania A: PANTHER: a library of protein families and subfa...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx
... (Shanghai) and presented as follows: Periostin (forward, 5’ AGGCAAACAG CTCAGAGTCTTCGT 3’ and reverse, 5’ TGCAGCTTCAAGTAGGCTGAGGAA 3’ ). b-actin (forward, 5’ CTGGCACCACACCTTCTA- CAATGA 3’ and ... Immunohistochemical staining of periostin in PCa and BPH. Negative epithelial and stromal periostin expression in BPH (a) and PCa(c). Positive epithelial and stromal periostin expres...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: "Developing a theoretical relationship between electrical resistivity, temperature, and film thickness for conductors" pptx
... equivalently η) as adjustable parameters. Again, a good match between experimental and theoretical data will demonstrate that the theoretical model is reliable and valid. The parameters for the theoretical ... with the bulk values, to reflect the change in the response of the atoms when the material has dimensions on the nanoscale. By adjusting the value of...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA" doc
... r 01-2676 01-2689 01-2690 Raccoon (Mi chigan, USA) A7 5/17 Dog (Co lorado, USA) Javelina Raccoon dogT anu(Japan) Dog (Taiwan) Dog Hamam (Japan) Dog KDK1 (Japan) Dog Ueno (Japan) G iant panda (C hina) Dog Yanaka (Japan) Dog ... species at the zoo that had been vaccinated. For this reason, use of that particular vaccine was discontinued; instead, Purevax™, a recombinant CDV-canary pox vir...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pptx
... mosaic virus (EACMV), East African cassava mosaic Cameroon virus (EACMCV), East African cassava mosaic Malawi virus (EACMMV), East Afri- can cassava mosaic Zanzibar virus (EACMZV) and South African ... (CMD)cassava mosaic geminiviruses (CMGs)African cassava mosaic virus (ACMV)East African cassava mosaic virus (EACMV)East African cassava mosaic Cameroon virus (EACMCV)geminiviru...
Ngày tải lên: 18/06/2014, 22:20