Báo cáo sinh học: " Reduced expression of Jak-1 and Tyk-2 proteins leads to interferon resistance in Hepatitis C virus " docx

Báo cáo sinh học: " Reduced expression of Jak-1 and Tyk-2 proteins leads to interferon resistance in Hepatitis C virus " docx

Báo cáo sinh học: " Reduced expression of Jak-1 and Tyk-2 proteins leads to interferon resistance in Hepatitis C virus " docx

... exposed to HCV slowly develop into chronic infec- tion. Long-standing chronic inflammation in the liver due to the virus infection leads to liver cirrhosis and carci- noma [1-7]. Infection with HCV ... for reduced inter- feron signaling in these replicon cells, expression of Jak- Stat proteins of interferon was examined. Interferon sign- aling occurs through a se...

Ngày tải lên: 18/06/2014, 18:20

13 305 0
Báo cáo sinh học: " Persistent expression of chemokine and chemokine receptor RNAs at primary and latent sites of herpes simplex virus 1 infection" pptx

Báo cáo sinh học: " Persistent expression of chemokine and chemokine receptor RNAs at primary and latent sites of herpes simplex virus 1 infection" pptx

... CTCTGTCACCTGCATGGCCTGGTCT CCR3 ACCAGCTGTGAGCAGAGTAAACAT CACAGCAGTGGGTGTAGGCA CACCTCAGTCACCTGCATGGCCA CCR5 ACTGCTGCCTAAACCCTGTCA GTTTTCGGAAGAACACTGAGAGATAA TCCGGAACTTCTCTCCAACAAAGGCA CCR6 TTGGTGCAGGCCCAGAAC GAACACGAGAACCACAGCGAT CCAAGAGGCACAGAGCCATCCGA CCR7 CTGCTACCTCATTATCATCCGTACCT ... CTCTGACCCTCCCACTTCCTGCTGTTT RANTES CTGTCATCGCTTGCTCTAGTCCTA CGGATGGAGATGCCGATTT ATCCCCTACTCCCACTCCGGTCCTG M...

Ngày tải lên: 18/06/2014, 22:20

12 307 0
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

... from the cytosolic fraction. Proteins in the cytosolic fraction were precipitated with cold acetone (1 : 1, v ⁄ v) for 60 min at )20 C and centrifuged at 13 000 g for 30 min at 4 C. The pellet ... (1988) Improved staining of proteins in polyacrylamide gels including isoelectric focusing gels with clear background at nanogram sensitivity using Coomassie Brilliant Blue G-250 and...

Ngày tải lên: 23/03/2014, 03:20

9 482 0
Báo cáo sinh học: " Differential expression of papillomavirus L1 proteins encoded by authentic and codon modified L1 genes in methylcellulose-treated mouse keratinocytes" ppt

Báo cáo sinh học: " Differential expression of papillomavirus L1 proteins encoded by authentic and codon modified L1 genes in methylcellulose-treated mouse keratinocytes" ppt

... KCs were respectively transfected with 2 μg of each of the four PV L1 plasmid Cell morphology and expression of involucrin in the primary mouse KCs grown in KC-SF medium containing different concen-tration ... concen-tration of methylcellulose for 2 daysFigure 1 Cell morphology and expression of involucrin in the primary mouse KCs grown in KC-SF medium containing di...

Ngày tải lên: 18/06/2014, 18:20

6 394 0
Báo cáo sinh học: "Elevated expression of CDK4 in lung cancer" pptx

Báo cáo sinh học: "Elevated expression of CDK4 in lung cancer" pptx

... Antisense:5’CGATTTCCAAAAAGCATG TAGACCAGGACCTAAGTCTCTTGAACTTAGGTCCT GGTCTACATGCGGGGA 3’) CDK4 1097 Sense:5’CGCG TCCCCGCAGCACTCTTATCTACATAATTCAAGA- GATTATGTAGATAAGAGTGCTGCTTTTTGGAAAT 3’ ;Antisense:5’ CGATTTCCAAAAAGCAGCACTCT- TATCTACATAATCTCTTGAATTATGTAGATAAG AGTGCTGCGGGGA ... 0- 6or7-12wasrespectivelyconsideredtobeloworhigh expression. Establishment of lung cancer A549 cell line with stably...

Ngày tải lên: 18/06/2014, 19:20

9 301 0
Báo cáo sinh học: "Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" pot

Báo cáo sinh học: "Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" pot

... International) and enhanced with SuperSignal Chemiluminescence kit (Pierce Biotechnology). Immunohistochemistry and scoring To investigate the significance of Her2 and Her3 expres- sion in HNSCC, 4-micron ... not shown). Her2 staining was scored based on the scoring system applied to breast cancers, with scores of 0,+1, +2, +3 for increas ing intensity and “ continuity” of...

Ngày tải lên: 18/06/2014, 22:20

10 491 0
Báo cáo sinh học: " Constitutive expression of Atlantic salmon Mx1 protein in CHSE-214 cells confers resistance to Infectious Salmon Anaemia virus" ppt

Báo cáo sinh học: " Constitutive expression of Atlantic salmon Mx1 protein in CHSE-214 cells confers resistance to Infectious Salmon Anaemia virus" ppt

... virulence. Vertebrates [9], including fish [10], mount an early strong innate immune response against virus infections, characterized by the induction and secretion of cytokines, such as type I interferons ... to replicate and cause CPE in CHSE-214 cells [7]. Total RNA was extracted from 300 µl of cell culture super- Table 1: Inhibition of ISAV NBISA01 by AsMx1 in CHSE-214 c...

Ngày tải lên: 19/06/2014, 08:20

6 318 0
Báo cáo khoa học: The expression of retinoblastoma and Sp1 is increased by low concentrations of cyclin-dependent kinase inhibitors ppt

Báo cáo khoa học: The expression of retinoblastoma and Sp1 is increased by low concentrations of cyclin-dependent kinase inhibitors ppt

... determination of mRNA levels, the primers were: 5¢-CGCCAAACTTGGGGGAAGCA-3¢ and 5¢-GAACC AGGTTTTCCGGCCCA-3¢ for DHFR; 5¢-GTGCCAAT GGCTGGCAGATCA-3¢ and 5¢-ACCATCCTGCTGCA CTTGGGC-3¢ for Sp1; 5¢-CTCCACACACTCCAGTT AGGA-3¢ ... 5¢-CTCCACACACTCCAGTT AGGA-3¢ and 5¢-CTGATTTAAGCATGGATTCCA-3¢ for Rb; and 5¢-CGCAGTTTCCCCGACTTCCC-3¢ and 5¢-GGCAGCGCACATGGTTCCTC-3¢ for adenine phos- phoribosyltra...

Ngày tải lên: 16/03/2014, 23:20

14 486 0
Báo cáo khoa học: Dual expression of mouse and rat VRL-1 in the dorsal root ganglion derived cell line F-11 and biochemical analysis of VRL-1 after heterologous expression pptx

Báo cáo khoa học: Dual expression of mouse and rat VRL-1 in the dorsal root ganglion derived cell line F-11 and biochemical analysis of VRL-1 after heterologous expression pptx

... 5¢-AT GACTTCAGCCTCCAGCCCCCCA-3¢ and rVRL-1_R: 5¢-GGGACTGGAGGACCTGAAGGGGCA-3¢, respect- ively) were used to clone the open reading frame of rVRL-1 in frame with GFP into the pcDNA3.1/CT-GFP-TOPO vector ... primers were designed according to the rat VRL-1 sequence (Acc. No. AF129113). rVRL-1–34F: 5¢-CTGGAGACTTCCGATGGAGA-3¢ and rVRL-1–568R: 5¢-CATCCGCTCCATTCTCTACC-3¢ to obtain frag...

Ngày tải lên: 31/03/2014, 07:20

8 439 0
báo cáo sinh học:" Nurses'''' experiences of recruitment and migration from developing countries: a phenomenological approach" pdf

báo cáo sinh học:" Nurses'''' experiences of recruitment and migration from developing countries: a phenomenological approach" pdf

... professional nursing practice that is common in Irish nursing practice. These included issues such as care planning and making nursing care decisions for patients in a system that required a greater degree of ... contributing to the shortage of nurses. High-income countries also face an increased demand for nurses due to the ageing workforce caring for increasing numbers of el...

Ngày tải lên: 18/06/2014, 17:20

7 473 0
w