Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt
Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt
... R5-TM-F,CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGGAGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT-GGACCATAGTATATATAGAATAGG and R5-TM-R, AATTCCTATTCTATATATACTATGGTCCACACGACTATT-GCTATGATTAGTGCTA CTATCAATGCTCCTACTC-CTAATTTATAATCTAAATTTAACATCTC. ... GAATTCACTACAGATCATCAATATCCCAAG; for the R5 vpu gene, Vpu- R5-F, GGATCCATGTTAAATTTA-GATTATAAATTAGGAGTA GG and Vpu- R5-R, GAAT-TCATTACAAATCATTAACATCCAAAAGCC. The amplifiedfragments designated as ... AGTAGTAGCAATAATAATAGCAATAGCTGTGT-GGTCCATAGTAATCATAGAATAGG and NL-TM-R,AATTCCTATTCTATGATTACTATGGACCACACAGCTATTGCTATTATTATTGCTACTACTAATGCTACTATTGCTAC-TATTATAGGTTGCATCTC; for the R5 vpu TM region, R5-TM-F,CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGGAGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT-GGACCATAGTATATATAGAATAGG...
- 11
- 436
- 0
Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx
... paper and was critical to study design and completion. All authors have read and approved the final manuscript.Author disclosure statementNanhai G. Chen, Qian Zhang, Yong A. Yu, and Aladar A. ... non-invasive imaging of virotherapy alters the replication and oncolytic capability of a novel vaccinia virus, GLV-1h153.Methods: GLV-1h153 was modified from parental vaccinia virus GLV-1h68 to carry ... including breast tumors [6],mesothelioma [7], canine breast tumors [8], pancreaticcancers [9], anaplastic thyroid cancers [10 ,11 ], mela-noma [12 ], and squamous cell carcinoma [13 ].Materials and methodsVirus...
- 14
- 490
- 0
Báo cáo hóa học: " The inhibition of the Human Immunodeficiency Virus type 1 activity by crude and purified human pregnancy plug mucus and mucins in an inhibition assay" ppt
... 8 and 9) and rabbit anti-MUC5B (lanes 10 , 11 and 12 ) polyclonal antibodies. Membranes were then incubated for 1 h with HRPO linked goat anti-mouse and goat anti-rabbit secondary antibodies and ... replication was measured by a qualitative p24 antigen assay. Let-ters a, b, c and d indicate the anti-HIV -1 activity of each sample in a serial tenfold dilution of 10 -1 , 10 -2, 10 -3 and 10 -4 ... the design and coordination of the study. ASM conceived of the study, participated in its design and coordination and finalised the manuscript. All authors read and approved the final manuscript.AcknowledgementsWe...
- 10
- 414
- 0
Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc
... Rad 51 L1 and L2 loops in DNA bindingYusuke Matsuo 1 , Isao Sakane2, Yoshimasa Takizawa 1 , Masayuki Takahashi3 and Hitoshi Kurumizaka 1, 2 1 Graduate School of Science and Engineering, Waseda ... under-standing the reaction mechanism and the regulation of homologous recombination.So far, the crystal structures of bacterial RecA, ar-chaeal Rad 51 (RadA), yeast Rad 51 (ScRad 51) , human Rad 51 (HsRad 51) , ... contact in the Rad 51 polymer. Rad 51- Y23 2A also exhibitedABCFEDFig. 2. Circular dichroism analysis and ATPase activities of the Rad 51 mutants. (A C) CD spectra of HsRad 51 (6.7 lM) and the Rad51...
- 12
- 662
- 0
Tài liệu Báo cáo khoa học: Oligomerization of the Mg2+-transport proteins Alr1p and Alr2p in yeast plasma membrane pptx
... B2-linker-ATTGTAACGGCTATATCTACTGGALR-c36SU3¢ B2-linker-GGCAAGAAGCTCGAAATAACCALR-c63SU3¢ B2-linker-CCAATAGCTGGCCAAGAACCALR-c96SU3¢ B2-linker-ATTCATACCGAAAAGACCC ALR2-HIS-f ATTTTTATGAGAAAACGTGAAAAAACTTCGTAATGTCGTCCTTATCGTACGCTGCAGGTCGACALR2-HIS-r ... AAACTGCAGGATTGTAACGGCTATATCTACE Alr1-rtp CAGGGTATGGATGAAACGGTTGCAlr1-rtm TGATCCCGAAGTGGAAGTAGAGCAlr2-rtp TTAAGTTCTAATGCGAGGCCATCCAlr2-rtm TTCGTTCACTGTGCCTTTGATGGACT1_plus ACCAAGAGAGGTATCTTGACTTTACGACT1_minus ... ATTTTTATGAGAAAACGTGAAAAAACTTCGTAATGTCGTCCTTATCGTACGCTGCAGGTCGACALR2-HIS-r AAAGATCTGCCGACCTACCATAGCGGTCATGTTAATTGTAACGGCATCGATGAATTCGAGCTCGALR2-up TTCGAAAAATGCAGCATTHIS3-r TCTACAAAAGCCCTCCTACCD ALR2mutR-EforCCAGGAGAGAATTCAAGTATTGCALR2mutR-ErevGCAATACTTGAATTCTCTCCTGGALR2-5¢SacII-f...
- 14
- 607
- 0
Báo cáo khoa học: Regulation of the human leukocyte-derived arginine aminopeptidase/endoplasmic reticulum-aminopeptidase 2 gene by interferon-c pot
... CGGGTACCTACTCAGGAAGCATGCAAGT (sense strand of the sequence from )67 to )47)for phLP4; CGGGTACCACAGAAAGTGAAAGCA(sense strand of the sequence from )33 to )18 ) forphLP5; CGACGCGTTGACTGAAGGGGAATTTACTTT(antisense ... site) and 5 ¢-CGACGCGTTGACTGAAGGGGAATTTACTTT-3¢ (antisense sequence of mutant Etssite) were used. For the construction of the double mutantplasmid, 5¢-GGGGTACCTACTCAAAGAGCATGCAAAGT-3¢ and ... the translocation of oxytocinase of human vascular endothelial cells viaactivation of oxytocin receptors. Endocrinology 14 1,44 81 4485. 14 Masuda S, Hattori A, Matsumoto H, Miyazawa S,Natori...
- 13
- 238
- 0
Báo cáo khoa học: Internalization of the human CRF receptor 1 is independent of classical phosphorylation sites and of b-arrestin 1 recruitment potx
... more than 50% of the cell specific associatedradioligand was internalized (Fig. 2). The internalizationreached a plateau after 10 –2 0 min, with a maximal radio-ligand internalization of 69%. ... presence of 10 )7Munlabelled CRF, was subtracted and the radio-activity internalized was expressed as a percentage of the sum of the surface radioactivity and the internalizedradioactivity. ... appearance of smallfluorescent intracellular vesicles was observed (Fig. 1A2 and A3 ). After 20 min of incubation, an aggregate of fluores-cence started t o appear near the nucleus of each cell (A4 )and...
- 9
- 300
- 0
báo cáo sinh học:" Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian medical sector" potx
... lack of a sustainable financial policy,inadequate infrastructure, under-trained faculty membersin some areas, poor instructional materials and equip-ment and lack of a formal evaluation and accreditationmechanism, ... Egypt and 3Suez Canal University, EgyptEmail: Galal Abdel-Hamid Abdellah - galalabdellah@mailer.eun.eg; Salah El-Din Mohamed Fahmy Taher - sftaher@yahoo.com; Somaya Hosny* - somaya_hosny@uicalumni.org* ... administrative aspects. Othersemphasized the practical and clinical skills, hospital safetymeasures, emergency and first aid measures, instrumentalanalysis, and clinical pharmacy.Share of the...
- 8
- 697
- 0
Báo cáo sinh học: " Purification of infectious human herpesvirus 6A virions and association of host cell proteins" pot
... Intviral protein ( #11 15 )/Inthostprotein ( #11 15 ) and in similar manner for 3 dpi medium.3Purification factor was estimated as the viral to host ratio in #11 15 divided by the similar ratio ... 11 15 , concentrated the samples by centrifugation, embedded the pellets in gela-tine and performed EM-analyses. The analyses of the gra-dient peak fractions 11 15 showed apparently intact and spherical ... 9 :14 3 -15 9.23. Huang ES, Chen ST, Pagano JS: Human cytomegalovirus. I. Puri-fication and characterization of viral DNA. J Virol 19 73, 12 :14 73 -14 81. 24. Talbot P, Almeida JD: Human cytomegalovirus:...
- 11
- 374
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ