Báo cáo sinh học: " Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity" ppt
Báo cáo sinh học: " Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity" ppt
... Access
Research
Repressor of temperate mycobacteriophage L1 harbors a stable
C-terminal domain and binds to different asymmetric operator
DNAs with variable affinity
Tridib Ganguly, Amitava Bandhu, Partho ... Ganguly - tridib_g@rediffmail.com; Amitava Bandhu - suvofriendster@gmail.com;
Partho Chattoraj - partho_chattoraj@rediffmail.com; Palas K Chanda -...
Báo cáo sinh học: " Evolution of temperate pathogens: the bacteriophage/bacteria paradigm" potx
... what
the diseases really are. Malaria and Sickle cell anemia are
an additional case that is relevant here. Similarly, we and
other organisms may be protected from many diseases by
having many ... the
development of new temperate pathogens of the same
class. A large class of plasmids of bacteria is non-transmis-
sible and individuals are propagated from mother to both
daugh...
Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf
... Mismatches are in red.
TCTTGTCAAAGCAAATAATA
3’
5’
Das primer, 9T1-1
CAAGTACTCAAATCAATGATGG
5’
3’
Gouvea primer, aBT1
Target sequence
Target sequence
CAAGTACTCAAATCAGTGATGG
TTTAGTTAAGGCAAATAATA
BioMed ... Sack
1
, Marc Van Ranst
2
and Tasnim Azim
1
Address:
1
ICDDR,B: Centre for Health and Population Research, Mohakhali, Dhaka-1212, Bangladesh and
2
Laboratory of Clinical and
Epi...
báo cáo sinh học:" Impact of an in-built monitoring system on family planning performance in rural Bangladesh" pdf
... Ashraf and Nirod Chandra Saha
Address: Health Systems and Infectious Diseases Division, International Centre for Diarrhoeal Disease Research, Bangladesh, Dhaka, Bangladesh
Email: Humayun Kabir* ... Hasan Y, Ashraf A, Islam M, Rahman MM, Rahman M, Kane TT, Bar-
kat-e-Khuda : Improving management support services. In
Improving the Bangladesh health and family planning program: lessons
le...
báo cáo sinh học:" Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian medical sector" potx
... financial policy,
inadequate infrastructure, under-trained faculty members
in some areas, poor instructional materials and equip-
ment and lack of a formal evaluation and accreditation
mechanism, a ...
3
Suez Canal University, Egypt
Email: Galal Abdel-Hamid Abdellah - galalabdellah@mailer.eun.eg; Salah El-Din Mohamed Fahmy Taher - sftaher@yahoo.com;
Somaya Hosny* - somaya_hosny@...
báo cáo sinh học:" Training of front-line health workers for tuberculosis control: Lessons from Nigeria and Kyrgyzstan" docx
... satisfaction related fac-
tors such as financial remuneration, working conditions,
management capacity and styles, professional advance-
ment and safety at work. These factors constitute a 'pro-
ductivity ... mix'
comprising other factors such as adequate motivation and
incentives, availability of required chemotherapy and
supplies for appropriate patient care, and ret...
báo cáo sinh học:" Development of a quality assurance handbook to improve educational courses in Africa" docx
... students and staff training and welfare. It has been piloted in Ghana and the
feedback was incorporated into the handbook. The handbook is currently available free of charge online
and being ... technical advice
about educational development. All authors contributed
to identifying materials for the handbook and this paper,
drafting the handbook and this paper, and have appro...
báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot
... Grenadines, and Surinam in 2003; to Barbados
and the Bahamas in 2004; and to Anguilla, Antigua & Bar-
buda, Dominica, Grenada, and Turks & Caicos in 2005.
Clinical Skills Course
Data from ... person in charge of VCT
services nor the participant was available, the interviewer
asked to speak with someone familiar with and able to
answer questions about VCT servic...
báo cáo sinh học:" Assessment of human resources for health using cross-national comparison of facility surveys in six countries" ppt
... Four of the countries were located in Africa
(Chad, Côte d'Ivoire, Mozambique and Zimbabwe), one
in Asia (Sri Lanka), and one in the region of Latin America
and the Caribbean (Jamaica). As ... also draws on a preliminary survey report
that benefited from the contributions of Khassoum Diallo, Alexandre Gou-
barev, Andrea Pantoja, Swati Sharma, Marko Vujicic and Pascal Zur...
báo cáo sinh học:" Mobility of primary health care workers in China" pdf
... Some graduates from medical
universities would rather take a non-medical job in an
urban area than work at a low-level health facility in a
rural area [17].
Conclusion
In China, primary health workers ... salaries. We cannot, because
our ability to generate revenues is limited. As head of
this THC, my concern is that some qualified health
professionals within the THC may want to l...
Từ khóa: