Báo cáo sinh học: " Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity" ppt

Báo cáo sinh học: " Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity" ppt

Báo cáo sinh học: " Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity" ppt

... Access Research Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity Tridib Ganguly, Amitava Bandhu, Partho ... Ganguly - tridib_g@rediffmail.com; Amitava Bandhu - suvofriendster@gmail.com; Partho Chattoraj - partho_chattoraj@rediffmail.com; Palas K Chanda -...

Ngày tải lên: 18/06/2014, 18:20

8 495 0
Báo cáo sinh học: " Evolution of temperate pathogens: the bacteriophage/bacteria paradigm" potx

Báo cáo sinh học: " Evolution of temperate pathogens: the bacteriophage/bacteria paradigm" potx

... what the diseases really are. Malaria and Sickle cell anemia are an additional case that is relevant here. Similarly, we and other organisms may be protected from many diseases by having many ... the development of new temperate pathogens of the same class. A large class of plasmids of bacteria is non-transmis- sible and individuals are propagated from mother to both daugh...

Ngày tải lên: 18/06/2014, 18:20

9 490 0
Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf

Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf

... Mismatches are in red. TCTTGTCAAAGCAAATAATA 3’ 5’ Das primer, 9T1-1 CAAGTACTCAAATCAATGATGG 5’ 3’ Gouvea primer, aBT1 Target sequence Target sequence CAAGTACTCAAATCAGTGATGG TTTAGTTAAGGCAAATAATA BioMed ... Sack 1 , Marc Van Ranst 2 and Tasnim Azim 1 Address: 1 ICDDR,B: Centre for Health and Population Research, Mohakhali, Dhaka-1212, Bangladesh and 2 Laboratory of Clinical and Epi...

Ngày tải lên: 19/06/2014, 08:20

5 389 0
báo cáo sinh học:" Impact of an in-built monitoring system on family planning performance in rural Bangladesh" pdf

báo cáo sinh học:" Impact of an in-built monitoring system on family planning performance in rural Bangladesh" pdf

... Ashraf and Nirod Chandra Saha Address: Health Systems and Infectious Diseases Division, International Centre for Diarrhoeal Disease Research, Bangladesh, Dhaka, Bangladesh Email: Humayun Kabir* ... Hasan Y, Ashraf A, Islam M, Rahman MM, Rahman M, Kane TT, Bar- kat-e-Khuda : Improving management support services. In Improving the Bangladesh health and family planning program: lessons le...

Ngày tải lên: 18/06/2014, 17:20

6 503 0
báo cáo sinh học:" Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian medical sector" potx

báo cáo sinh học:" Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian medical sector" potx

... financial policy, inadequate infrastructure, under-trained faculty members in some areas, poor instructional materials and equip- ment and lack of a formal evaluation and accreditation mechanism, a ... 3 Suez Canal University, Egypt Email: Galal Abdel-Hamid Abdellah - galalabdellah@mailer.eun.eg; Salah El-Din Mohamed Fahmy Taher - sftaher@yahoo.com; Somaya Hosny* - somaya_hosny@...

Ngày tải lên: 18/06/2014, 17:20

8 697 0
báo cáo sinh học:" Training of front-line health workers for tuberculosis control: Lessons from Nigeria and Kyrgyzstan" docx

báo cáo sinh học:" Training of front-line health workers for tuberculosis control: Lessons from Nigeria and Kyrgyzstan" docx

... satisfaction related fac- tors such as financial remuneration, working conditions, management capacity and styles, professional advance- ment and safety at work. These factors constitute a 'pro- ductivity ... mix' comprising other factors such as adequate motivation and incentives, availability of required chemotherapy and supplies for appropriate patient care, and ret...

Ngày tải lên: 18/06/2014, 17:20

9 422 0
báo cáo sinh học:" Development of a quality assurance handbook to improve educational courses in Africa" docx

báo cáo sinh học:" Development of a quality assurance handbook to improve educational courses in Africa" docx

... students and staff training and welfare. It has been piloted in Ghana and the feedback was incorporated into the handbook. The handbook is currently available free of charge online and being ... technical advice about educational development. All authors contributed to identifying materials for the handbook and this paper, drafting the handbook and this paper, and have appro...

Ngày tải lên: 18/06/2014, 17:20

5 488 0
báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot

báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot

... Grenadines, and Surinam in 2003; to Barbados and the Bahamas in 2004; and to Anguilla, Antigua & Bar- buda, Dominica, Grenada, and Turks & Caicos in 2005. Clinical Skills Course Data from ... person in charge of VCT services nor the participant was available, the interviewer asked to speak with someone familiar with and able to answer questions about VCT servic...

Ngày tải lên: 18/06/2014, 17:20

8 450 0
báo cáo sinh học:" Assessment of human resources for health using cross-national comparison of facility surveys in six countries" ppt

báo cáo sinh học:" Assessment of human resources for health using cross-national comparison of facility surveys in six countries" ppt

... Four of the countries were located in Africa (Chad, Côte d'Ivoire, Mozambique and Zimbabwe), one in Asia (Sri Lanka), and one in the region of Latin America and the Caribbean (Jamaica). As ... also draws on a preliminary survey report that benefited from the contributions of Khassoum Diallo, Alexandre Gou- barev, Andrea Pantoja, Swati Sharma, Marko Vujicic and Pascal Zur...

Ngày tải lên: 18/06/2014, 17:20

9 502 0
báo cáo sinh học:" Mobility of primary health care workers in China" pdf

báo cáo sinh học:" Mobility of primary health care workers in China" pdf

... Some graduates from medical universities would rather take a non-medical job in an urban area than work at a low-level health facility in a rural area [17]. Conclusion In China, primary health workers ... salaries. We cannot, because our ability to generate revenues is limited. As head of this THC, my concern is that some qualified health professionals within the THC may want to l...

Ngày tải lên: 18/06/2014, 17:20

5 426 0
Từ khóa:
w