Báo cáo sinh học: " Carlow Virus, a 2002 GII 4 variant Norovirus strain from Ireland" pot
Báo cáo sinh học: " Carlow Virus, a 2002 GII.4 variant Norovirus strain from Ireland" pot
... AAT00 249 48 1 T 540 AAR97651 48 1 540 AAT00 348 48 1 540 AAR32988 48 1 540 ABC96 746 48 1 A 540 BAF38397 48 0 P A 539 AAL18873 48 1 Y P V 540 AAD4 049 7 48 0 P A 539 AAT12693 48 0 P A 539 AAD4 048 8 ... TTGATTGATATTGTGAAGTC (44 36 44 55) - 5090 R TCATTCGACGCCATCTTCATT (50 84 51 04) - 42 90 F TCACTATGATGCTGATTACTC (42 82 43 02) - NLV1S25F GTGAATGAAGATGGCGTCTAACGAC...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Carlow Virus, a 2002 GII.4 variant Norovirus strain from Ireland" pot
... AAR97 645 48 1 540 AAT002 34 481 540 AAT00327 48 1 540 AAR97663 48 1 540 AAS89 040 48 1 540 AAT00339 48 1 540 AAT00 249 48 1 T 540 AAR97651 48 1 540 AAT00 348 48 1 540 AAR32988 48 1 540 ABC96 746 48 1 A 540 ... [29] ORF3minusdegen ATCTCCTTRTCATGWTTRAARGAAGCC (6868–68 94) - 43 0F ATGTGGGAYGGRGAGATCTAC (398 41 8) + 44 40 minus TCGTTGATTGATATTGTGAAGTC (44 36 44 58) - 4...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo sinh học: " Seewis virus, a genetically distinct hantavirus in the Eurasian common shrew (Sorex araneus)" doc
... 5'- TACCAATCTTATCTGCGTC-3' and CBS-3'endR: 5'-TAG- TAGTAKRCTCCYTRAA-3' for the S segment; OSV697 and T-M 148 5R: 5'-CCAGCCAAARCARAATGT-3', then T- M1199F: 5'-TAAVTTCAMCAAC ATGTCT-3' ... and T- M 148 5R for the M segment; and OSM55 and T-L 145 4R: 5'-ATGCCC WATATGCCATGC-3', then OSM55 and T- L390R: 5'-GTCACWGTRACCTC-3', MJN L181F...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition potx
... designed; pA12L- forward: 5'-CACTCCATGGATGGCGG ATAAAAAAAATT- TAGCC and pA12L-reverse: 5'-CAGGATCCTTAATACAT- TCCCATATCCA GACAAC; p233-forward: 5'- ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: ... (Stratagene) with a specific primer, which has the changed sequences at the residues 55–57 (underlined), 5'- CTTAATTCTCAAACAGATGTGACTATCGACATC TGTGA- TACAAAATCAAAGAGTTCA-3'....
Ngày tải lên: 18/06/2014, 18:20
báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf
... the causal pathways between pay satisfaction, job satisfaction, organizational commitment and turnover intent [7]. The overall conclusion was that nurses, who are satisfied with job and pay, are ... satisfaction data at 6 and 18 months using principal component analysis with var- imax rotation and Kaiser normalization to ascertain whether the eight factors (Care, Staffing, Development, Relati...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Development of a quality assurance handbook to improve educational courses in Africa" docx
... [http://www-wds.worldbank.org/servlet/ WDS_IBank_Servlet?pcont=details&eid=0000 949 46_00 041 90 549 23 67]. Washington, DC: Task Force on Higher Education and Society (accessed 29/12/2007). 8. Damme DV: Internationalization and quality assurance: Towards ... Assurance Agency for Higher Education: United Kingdom. Mansfield 1997 [http://www.qaa.ac.uk ]. (accessed 26/11/2008). 16. Bates I,...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot
... Grenadines, and Surinam in 2003; to Barbados and the Bahamas in 20 04; and to Anguilla, Antigua & Bar- buda, Dominica, Grenada, and Turks & Caicos in 2005. Clinical Skills Course Data from the ... information about course participants and trainers. Drawing from this database, a telephone survey followed up on program-trained VCT providers; an external evaluation analyzed data on...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Training evaluation: a case study of training Iranian health managers" docx
... each technique on a four-point scale (not at all satis- Importance of ways of learning about health planning and managementFigure 1 Importance of ways of learning about health planning and management. 0.0 ... uses material from local health management situations to demonstrate key theories and develop locally required skills. Training evaluations should as a minimum assess participants&...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Migration as a form of workforce attrition: a nine-country study of pharmacists" pptx
... coordinators: Brooke Myers, Australia; Mamunur Rashid, Bangladesh; Maja Kovacevic, Croatia; Mohammed Atef Abd El Hakim, Egypt; Suresh Panthee and Ganesh Subedi, Nepal; Pedro Lucas and Andreia Bruno, ... (South Africa) and MEDACT (UK) 19. Labonte R, Packer C, Klassen N: Managing health professional migration from sub-Saharan Africa to Canada: a stakeholder inquiry into policy options. H...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Experience with a "social model" of capacity building: the Peoples-uni" ppt
... tutors agreed to act as online facilitators, and 25 have been active. Each course module has one general facilitator to oversee the process, and each topic has one facilitator, who thus may have a ... colleagues became trustees, and others became members of an international advisory group or a quality assurance and educational oversight group, each of which was expanded by further members...
Ngày tải lên: 18/06/2014, 17:20