Báo cáo sinh học: " Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple steps" pptx
Báo cáo sinh học: " Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple steps" pptx
... number not for citation purposes) Virology Journal Open Access Research Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple steps Nicola ... and premature polyadenylation prevent expression of RSV-F by RNA polymerase II dependent expression plasmids. Since RSV replicates in the cytoplasm,...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Characterization of vaccinia virus A12L protein proteolysis and its participation in virus assembly" pptx
... mutant virus. References 1. DeLange AM: Identification of temperature sensitive mutants of vaccinia virus that are defective in conversion of concate- meric replicative intermdediates to the mature ... con- firm that the A12L proteolytic processing is regulated by rifampicin (Fig. 2C). The hypothesis that the rifampicin- arrested proteolysis of A12L would be re-initiated by...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Improvement of cardiac contractile function by peptide-based inhibition of NF-B in the utrophin/dystrophin-deficient murine model of muscular dystrophy" potx
... the hearts of most of dko mice in this study regardless of treatment (5 of 7 [71%] NBD treated mice, versus 3 of 4 [75%] vehicle treated mice). Of note, the eight week-old vehicle and NBD treated dko ... treatment of dko mice resu lted in an i mprovement in cardiac histopatho- logical features of this model. Between eight and ten weeks -of- age, dko mice display myocardial dam...
Ngày tải lên: 18/06/2014, 19:20
Tài liệu Báo cáo khoa học: Selection of stably folded proteins by phage-display with proteolysis docx
... advant- age of the computational methods is that they can examine very large numbers of mutations [27]. The limitation of the current computational methods, however, is that most of the computer ... lack of intrinsic consistency and reliability of the computational methods [35]. In comparison with the computational method, the major limitation of the phage-display and proteo...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: Phosphorylation of NF-jB proteins by cyclic GMP-dependent kinase A noncanonical pathway to NF-jB activation potx
... phosphorylation of p49 by PKG but much less by PKA, and the phosphorylation of p65 by PKA and PKG on distinct residues implies multiple modes of regulation of NF-jB function. It also indicates that the ... pathway, associated with the T-cell antigen receptor that is induced by superantigen and leads to activation of PKG and activation-induced cell death [3]. Because T-ly...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: Modulation of the endocannabinoid system by focal brain ischemia in the rat is involved in neuroprotection afforded by 17b-estradiol pdf
... and water. Neuropathology and quantification of ischemic damage Cerebral infarct volume was evaluated 22 h after reperfu- sion in rats subjected to 2 h of MCAo. Rats were killed by decapitation, ... modulation by E 2 after MCAo FEBS Journal 274 (2007) 4464–4475 ª 2007 The Authors Journal compilation ª 2007 FEBS 4471 modulation of the endocannabinoid system is implicated in the mech...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo sinh học: " Detection of virus mRNA within infected host cells using an isothermal nucleic acid amplification assay: marine cyanophage gene expression within Synechococcus sp" potx
... TCGTCTTCCGGTCTCTCCTCT CAAGCCTCAGCGCTCTCTCTC CCTATAGTGAGTCGTATTAATT TCGAAhACGTGACATTACATCA CGCAAGTATTGTTx TCGTCTTCCGGTCTCTCCTCTCA AGCCTCAGCGCTCTCTCTCCCT ATAGTGAGTCGTATTAATTTCGA AhACAGAAACAAGCTTGTTTACG ATGGTCAAx Facilitator 1 TGCTTTTTATCATCACGAATC TCTCCTGTTx ATGTTGGTAATCTACCAAAGGTA AAGGCAGx Facilitator ... efficiency of 3WJ formation is greatly enhanced by the use of facilitator probes...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Soilborne wheat mosaic virus (SBWMV) 19K protein belongs to a class of cysteine rich proteins that suppress RNA silencing" docx
... PVX CP antiserum show similar levels of PVX.GFP virus (lanes 1–4) and PVX.19K virus (lanes 5–8). Lane 9 con- tains extract of non inoculated plants. (B) Northern analysis of RNA isolated from ... 15(3):269-280. 11. Scholthof HB, Scholthof KB, Jackson AO: Identification of tomato bushy stunt virus host-specific symptom determinants by expression of individual genes from a...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" doc
... the presence of IPTG exhib- ited ribosomal RNA degradation. This effect is mediated by RNase L since a similar pattern of rRNA cleavage products is observed by the co -expression of RNase L and 2-5AS ... synthesis by the nonstructural proteins NS4A and NS4B of hepatitis C virus. Virus Res 2002, 90:119-131. 43. Kato J, Kato N, Yoshida H, Ono-Nita SK, Shiratori Y, Omat...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo sinh học: " Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation-RNA replication system by viral protein 3CDpro" docx
... by the addition of extra 3CD pro . Our results indicate that the stimulation of RNA synthesis and virus maturation by 3CD pro in vitro is dependent on the presence of a VPg-linked RNA template. Published: ... http://www.virologyj.com/content/2/1/86 Page 14 of 19 (page number not for citation purposes) sented in this paper indicate that the stimulatory effect of 3CD pr...
Ngày tải lên: 19/06/2014, 08:20