báo cáo sinh học:" Sending money home: a mixed-Methods study of remittances by migrant nurses in Ireland" docx
báo cáo sinh học:" Sending money home: a mixed-Methods study of remittances by migrant nurses in Ireland" docx
... strug- gling to meet their financial obligations in Ireland and back home. Increased taxes and the reduced availability of overtime have hit migrant nurses hard and yet their finan- cial obligations are ... emerging research themes. Further inductive analysis was conducted via a thorough re-reading of inter- view transcripts [19]. Data management and analysis were facilitated by...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" “More money for health - more health for the money”: a human resources for health perspective" pdf
... in 2007 indicated that 25% of all funds are allocated to human resources and training, and 42% of all activities in Board-approved Round 8 proposals related to human resources and training [21]. ... the G8 as required by their annual Accountability Framework). The World Health Organization (WHO) ‘working lifespan strategies’ is promoted as a roadmap for training, sustaining and re...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Sharing best practices through online communities of practice: a case study" potx
... developmental status of students, allocation of scarce clinical and academic resources, space within an already crowded program of study and clinical compe- tency of available faculty must all be ... to analysis of GAPS forums: Barb Deller and Ricky Lu. Other moderators: Julia Bluestone and Barb Deller. Acquisition of data and monitoring of submissions: Karnika Bhalla and Alis...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" The current shortage and future surplus of doctors: a projection of the future growth of the Japanese medical workforce" pdf
... Life Table. Pass rate for Japanese national examination for medical practitioners Pass rates remain constant at the rate achieved in the last decade (2000- 2009). Male/female ratio of new medical ... of the future growth of the Japanese medical workforce Hideaki Takata 1* , Hiroshi Nagata 2† , Hiroki Nogawa 3† and Hiroshi Tanaka 4† Abstract Background: Starting in the late 1980s, th...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: "Shipping blood to a central laboratory in multicenter clinical trials: effect of ambient temperature on specimen temperature, and effects of temperature on mononuclear cell yield, viability and immunologic function" potx
... Virginia. Data were analyzed with FlowJo software (Treestar, Ashland OR). Testing of Blood Shipping Packages The standard shipping container used in our clinical trials was obtained from Safeguard ... found that shipping of blood in insulated containers by contracted overnight carriers is associated with large seasonal varia- tions in temperature inside the packaging, ranging from...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: "High ERCC1 expression predicts cisplatin-based chemotherapy resistance and poor outcome in unresectable squamous cell carcinoma of head and neck in a betel-chewing area" pdf
... ERCC1 and XRCC1 and radioresistance in laryngeal tumors [33]. Cetuximab is an IgG1 monoclonal antibody against the ligand-binding domain of EGFR. Cetuximab binds Table 3 Univariate analyses of prognostic ... Chemotherapy added to locoregional treatment for head and neck squamous-cell carcinoma: three meta-analyses of updated individual data. MACH-NC Collaborative Group. Meta-Analysis...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf
... 285 :20252-20261. 29. Wang S, Parker C, Taaffe J, Solorzano A, Garcia-Sastre A, Lu S: Heterologous HA DNA vaccine prime–inactivated influenza vaccine boost is more effective than using DNA or inactivated vaccine alone ... disease Hayk Davtyan 1,2 , Anahit Ghochikyan 1 , Richard Cadagan 3 , Dmitriy Zamarin 3 , Irina Petrushina 2 , Nina Movsesyan 2 , Luis Martinez-Sobrido 4 , Randy A Albrec...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Periodic solutions for a class of higher order difference equations" potx
... equations Huantao Zhu 1 and Weibing Wang ∗2 1 Hunan College of Information, Changsha, Hunan 410200, P.R. China 2 Department of Mathematics, Hunan University of Science and Technology, Xiangtan, ... improve the article. The study was supported by the NNSF of China (10871063) and Scientific Research Fund of Hunan Provincial Education Department (10B017). References [1] Agarwal, RP:...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
... S RNA of TULV. GGAAAUG GCCAAGU G-C A- U G-C A- U U -A G G U -A G:U C A- U U -A 337 381 (+) sense U:G U -A C U C-G U -A C-G U -A C-G U -A A-U C C A- U C A G U -A A-U (-) sense A C A- U G A G-C A- U CCUUUAC ... weaker due to the fact that two non-canonical G:U base pairs presented in the plus-sense RNA occur as non- pairing C /A bases in the minus-sense RNA. Interesti...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... GTGTTCGACTTTGCCAGCCTGTACCCCAGCATCATCCAGGCCCACAACCTGTGC VZV GTATTGGATTTTGCAAGTTTATATCCAAGTATAATTCAGGCCCATAACTTATGT HHV6 GTGTTTGATTTTCAAAGTTTGTATCCGAGCATTATGATGGCGCATAATCTGTGT CMV GTGTTCGACTTTGCCAGCCTCTACCCTTCCATCATCATGGCCCACAACCTCTGC ... GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC EHV2 GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC MHV68 GTAGTGGACTTTGCCAGCCTGTACCCA...
Ngày tải lên: 18/06/2014, 22:20