báo cáo sinh học:" Knowledge and communication needs assessment of community health workers in a developing country: a qualitative study" docx

Báo cáo khoa học: Flexibility and communication within the structure of the Mycobacterium smegmatis methionyl-tRNA synthetase Henrik Ingvarsson and Torsten Unge potx

Báo cáo khoa học: Flexibility and communication within the structure of the Mycobacterium smegmatis methionyl-tRNA synthetase Henrik Ingvarsson and Torsten Unge potx

... 2010 The Authors Journal compilation ª 2010 FEBS Flexibility and communication within the structure of the Mycobacterium smegmatis methionyl-tRNA synthetase Henrik Ingvarsson and Torsten Unge Department ... amide groups of Ile128 and Arg129. Despite these differences in the coordination of the res- idues in the tip, the fold of the loop is...

Ngày tải lên: 06/03/2014, 22:21

16 515 0
báo cáo sinh học:" HIV and infant feeding counselling: challenges faced by nurse-counsellors in northern Tanzania" pptx

báo cáo sinh học:" HIV and infant feeding counselling: challenges faced by nurse-counsellors in northern Tanzania" pptx

... Access Research HIV and infant feeding counselling: challenges faced by nurse-counsellors in northern Tanzania Sebalda C Leshabari* 1,2 , Astrid Blystad 2,4 , Marina de Paoli 5 and Karen M Moland 2,3 Address: ... been trained specifically in HIV and infant feeding counselling, while sixteen had received four weeks of orientation train- ing for general HIV...

Ngày tải lên: 18/06/2014, 17:20

11 540 0
báo cáo sinh học:" Measuring and managing the work environment of the mid-level provider – the neglected human resource" pdf

báo cáo sinh học:" Measuring and managing the work environment of the mid-level provider – the neglected human resource" pdf

... Central Page 1 of 9 (page number not for citation purposes) Human Resources for Health Open Access Research Measuring and managing the work environment of the mid-level provider – the neglected human ... motivation and performance of mid-level providers. This paper explores the work environment of mid-level providers in Malawi, and contribut...

Ngày tải lên: 18/06/2014, 17:20

9 455 0
báo cáo sinh học:" Burnout and use of HIV services among health care workers in Lusaka District, Zambia: a cross-sectional study" pot

báo cáo sinh học:" Burnout and use of HIV services among health care workers in Lusaka District, Zambia: a cross-sectional study" pot

... support and coopera- tion. We thank Mary Banda (Lusaka Urban District Health Management Team) and Graham Samungole (Lusaka Urban District Health Management Team) for their assistance in study ... rates are high and before ART was available, death was a common cause of attrition among district health care workers [14,15]. A recent South African survey measured HI...

Ngày tải lên: 18/06/2014, 17:20

10 502 0
báo cáo sinh học:" Employment and sociodemographic characteristics: a study of increasing precarity in the health districts of Belo Horizonte, Brazil" pdf

báo cáo sinh học:" Employment and sociodemographic characteristics: a study of increasing precarity in the health districts of Belo Horizonte, Brazil" pdf

... for Health Open Access Research Employment and sociodemographic characteristics: a study of increasing precarity in the health districts of Belo Horizonte, Brazil Maria Cristina Ramos de Vasconcellos ... competing interests. Authors' contributions MC, AA and SB jointly formulated the study design. MC obtained the data. MC and AA were involved...

Ngày tải lên: 18/06/2014, 17:20

13 544 0
báo cáo sinh học:" Knowledge and communication needs assessment of community health workers in a developing country: a qualitative study" docx

báo cáo sinh học:" Knowledge and communication needs assessment of community health workers in a developing country: a qualitative study" docx

... Communication Programs (PAIMAN), Islamabad, Pakistan and 2 Health Systems and Policy Unit, Federal Ministry of Health, Islamabad, Pakistan Email: Zaeem Haq* - drzaeem@hotmail.com; Assad Hafeez - az10@hotmail.com * ... and communication needs assessment of community health workers in a developing country: a qualitative study Zaeem Haq* 1 and Assad Ha...

Ngày tải lên: 18/06/2014, 17:20

7 438 0
báo cáo sinh học:" Contracting private sector providers for public sector health services in Jalisco, Mexico: perspectives of system actors" ppt

báo cáo sinh học:" Contracting private sector providers for public sector health services in Jalisco, Mexico: perspectives of system actors" ppt

... 1 of 11 (page number not for citation purposes) Human Resources for Health Open Access Case study Contracting private sector providers for public sector health services in Jalisco, Mexico: perspectives ... audio-recorded by a team of three field researchers. Informed consent for all inform- ants was obtained prior to the beginning of the interview. The...

Ngày tải lên: 18/06/2014, 17:20

11 420 0
Báo cáo sinh học: " Phenotype and envelope gene diversity of nef-deleted HIV-1 isolated from long-term survivors infected from a single source" pptx

Báo cáo sinh học: " Phenotype and envelope gene diversity of nef-deleted HIV-1 isolated from long-term survivors infected from a single source" pptx

... Access Research Phenotype and envelope gene diversity of nef-deleted HIV-1 isolated from long-term survivors infected from a single source Lachlan Gray 1,2 , Melissa J Churchill 1 , Jasminka ... DG, ALC, DAM and PRG analyzed and interpreted the data; PRG designed and oversaw the study, and wrote the manuscript. All authors read and approved the manusc...

Ngày tải lên: 18/06/2014, 18:20

12 401 0
Báo cáo sinh học: "Etiology and antibiotic resistance patterns of community-acquired urinary tract infections in J N M C Hospital Aligarh, India" potx

Báo cáo sinh học: "Etiology and antibiotic resistance patterns of community-acquired urinary tract infections in J N M C Hospital Aligarh, India" potx

... Antimicrobials Open Access Research Etiology and antibiotic resistance patterns of community-acquired urinary tract infections in J N M C Hospital Aligarh, India Mohammed Akram 1 , Mohammed Shahid 2 and Asad ... used antimicrobilas among pathogens of both bacteremic and non-bacteremic community-acquired urinary tract infec- tion. J Microbial Imm...

Ngày tải lên: 08/08/2014, 19:20

7 320 0
Báo cáo y học: "Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis" pot

Báo cáo y học: "Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis" pot

... activation and aggrecan and collagen release. Materials and methods Cartilage degradation assay Bovine nasal cartilage was cultured as previously described [20]. Briefly, bovine nasal septum cartilage ... ATATTTATACGCCTTTTGATTCCT 297 GGTACCCGTAGAGCTTCCGTTCC α 2 M GCCCGCTTTGCCCCTAACA 359 TCGTCCACCCCACCCTTGATG RECK GTAATTGCCAAAAAGTGAAA 352 TAGGTGCATATAAACAAGAAGTA ADAMTS-1 GCTGCC...

Ngày tải lên: 09/08/2014, 08:22

12 526 0
Báo cáo khoa học: " Feasibility and early clinical assessment of flattening filter free (FFF) based stereotactic body radiotherapy (SBRT) treatments" pptx

Báo cáo khoa học: " Feasibility and early clinical assessment of flattening filter free (FFF) based stereotactic body radiotherapy (SBRT) treatments" pptx

... [http://ctep.cancer.gov]. doi:10.1186/1748-717X-6-113 Cite this article as: Scorsetti et al.: Feasibility and early clinical assessment of flattening filter free (FFF) based stereotactic body radiotherapy (SBRT) treatments. Radiation Oncology 2011 ... Vanetti 2 and Luca Cozzi 2 Abstract Purpose: To test feasibility and safety of clinical usage of...

Ngày tải lên: 09/08/2014, 09:21

8 315 0
Báo cáo y học: "Barriers and supports to implementation of MDI/spacer use in nine Canadian pediatric emergency departments: a qualitative study" ppsx

Báo cáo y học: "Barriers and supports to implementation of MDI/spacer use in nine Canadian pediatric emergency departments: a qualitative study" ppsx

... implementing MDI/spacer research and to identify factors associated with early and late adoption of MDI/spacers in Canadian PEDs. Methods: Using a comparative case study design, we classified nine ... process. While individual clinicians may be aware of the advantages of MDI/spacer use, the actually 'adoption' of MDI/spacers is actually an institutional or...

Ngày tải lên: 11/08/2014, 05:21

10 308 0
báo cáo khoa học: " Barriers and supports to implementation of MDI/spacer use in nine Canadian pediatric emergency departments: a qualitative study" pps

báo cáo khoa học: " Barriers and supports to implementation of MDI/spacer use in nine Canadian pediatric emergency departments: a qualitative study" pps

... cov- ered, as well as the initial coding of the data and the organization of the emergent barriers and facilitators. Data were used to make cross-case (i.e., pediatric ED to pediatric ED) and cross-category ... study were to determine the barriers and supports to implementing MDI/spacers into PED practice, and identify factors associated with early and late a...

Ngày tải lên: 11/08/2014, 16:20

10 331 0
Báo cáo sinh học: "Antibacterial and resistance-modifying activities of thymoquinone against oral pathogens" ppsx

Báo cáo sinh học: "Antibacterial and resistance-modifying activities of thymoquinone against oral pathogens" ppsx

... resistance-modifying activities of thymoquinone against oral pathogens. Annals of Clinical Microbiology and Antimicrobials 2011 10:29. Submit your next manuscript to BioMed Central and take full advantage of: ... Annals of Clinical Microbiology and Antimicrobials 2011, 10:29 http://www.ann-clinmicrob.com/content/10/1/29 Page 5 of 7 RESEARC H Open Access Antibacterial...

Ngày tải lên: 12/08/2014, 17:20

7 220 0
Báo cáo y học: "Acute and delayed mild coagulopathy are related to outcome in patients with isolated traumatic brain injury" docx

Báo cáo y học: "Acute and delayed mild coagulopathy are related to outcome in patients with isolated traumatic brain injury" docx

... al.: Acute and delayed mild coagulopathy are related to outcome in patients with isolated traumatic brain injury. Critical Care 2011 15:R2. Submit your next manuscript to BioMed Central and take ... Access Acute and delayed mild coagulopathy are related to outcome in patients with isolated traumatic brain injury Sjoerd Greuters 1* ,...

Ngày tải lên: 14/08/2014, 07:21

7 315 0
w