báo cáo sinh học:" Burnout and use of HIV services among health care workers in Lusaka District, Zambia: a cross-sectional study" pot
... support and coopera- tion. We thank Mary Banda (Lusaka Urban District Health Management Team) and Graham Samungole (Lusaka Urban District Health Management Team) for their assistance in study ... rates are high and before ART was available, death was a common cause of attrition among district health care workers [14,15]. A recent South African survey measured HI...
Ngày tải lên: 18/06/2014, 17:20
... robustness and reliability, and industry to finalize a product that will receive a European Community marking (CE mark) and a U.S. marking (Food and Drug Administration (FDA)) approval. Generation and ... protocols for mechanical ventilation? The human brain has a limited ability to incorporate data and information in decision making and human memory can simultan...
Ngày tải lên: 18/06/2014, 18:20
... (Amsterdam, Netherlands) 2002, 62:15-29. 21. Exadaktylos NM: Organisation and financing of the health care systems of Bulgaria and Greece what are the parallels? BMC health services research 2005, ... I, Papadakis V, Katsika A, Sarafidou J, Laskari H, Anastasopoulos I, Vessalas G, Bouhoutsou D, Papaevangelou V, et al.: Burnout, staff support, and coping in Pediatric...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf
... reliably annotated gold standard to support experimenting with such applications. This research is also a case study of ana- lyzing and improving manual tagging that is applicable to any tagging ... 504 Table 1: Four-Category Contingency Table ration, in which certainty ratings 0 and 1 are combined and ratings 2 and 3 are combined. Note that the analyses described in t...
Ngày tải lên: 23/03/2014, 19:20
Báo cáo Y học: Engineering and use of 32P-labeled human recombinant interleukin-11 for receptor binding studies docx
... third PCR using two primers G353 (5¢- GGAATTCCATATGGACTACAAGGATGACGATG ACAAG-3¢) and G354 (5¢-ATAGTTTAGCGGCCGCT CACAGCCGAGTCTTCAG-3¢) and the above plasmid as template. The expression plasmid pET-FCPDIL1 ... Verschueren) were maintained in DMEM containing 10% fetal bovine serum and 2 m M glutamine. All cell lines were maintained at 37 °Cand5% CO 2 . IL-11 bioassay IL-11 activity was m...
Ngày tải lên: 24/03/2014, 00:21
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx
... for intranasal administration to infants and young children. The intranasal route of administra- tion is needle-free and has the advantage of direct stimu- lation of local immunity as well as induction ... Access Research Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes Emmalene J...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Detection and frequency of recombination in tomato-infecting begomoviruses of South and Southeast Asia" pptx
... Journal Open Access Research Detection and frequency of recombination in tomato-infecting begomoviruses of South and Southeast Asia HC Prasanna* and Mathura Rai Address: Indian Institute of Vegetable ... Vegetable Research, P B 5002, P 0-B H U, Varanasi, Uttar Pradesh, 221005, India Email: HC Prasanna* - prasanahc@yahoo.com; Mathura Rai - mathura.rai@gmail.com * Corresponding a...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Construction and characterization of recombinant flaviviruses bearing insertions between E and NS1 genes" docx
... bp) was based on the amplifi- cation of the YF T3 plasmid [6] with oligonucleotides RG330 (5'CTCGGCATGG ACGAGCTGTACAAGAAGTT- GTTCACTCAGACCATGAAAGGC 3') and RG331 (5'GCC AAAGTTGATGGCGCATCCTTGATCGGCGCCAACTCCTA GAGAC ... obtained after RNA transfection. Two independent series of serial passages (at MOI of 0.02); P1 and P2 were analyzed by RT-PCR and flow citometry at p...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "Construction and characterization of an infectious clone of coxsackievirus A16" docx
... Xba I CV(1–4392) amplification P3 CTACGCTCTAGAAAGAAGGA Xba I CV(4381–7410) amplification P4 ACAAGCGGCCGCTGCTATTCTGGTTATAAC Not I CV(4381–7410) amplification P5 CTTCTCGAGGTTGATTTTGAGCAAGCATTG ... study and wrote the manuscript. QL participated in the study design and data analyses. All authors read and approved the final manuscript. Acknowledgements We thank Drs Bing Sun and Q...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "Safety and pharmacokinetics of recombinant human hepatocyte growth factor (rh-HGF) in patients with fulminant hepatitis: a phase I/II clinical trial, following preclinical studies to ensure safety" ppt
... Morishita R, Aoki M, Hashiya N, Makino H, Yamasaki K, Azuma J, Sawa Y, Matsuda H, Kaneda Y, Ogihara T: Safety evaluation of clinical gene therapy using hepatocyte growth factor to treat peripheral arterial disease. ... of age, and male Wistar rats, seve n weeks of age, were obtained from Japan Farm (Kagoshima, Japan) and Charles River Laboratories Japan Inc. (Yokohama, Japan), respe...
Ngày tải lên: 18/06/2014, 19:20