báo cáo sinh học:" Conflicting priorities: evaluation of an intervention to improve nurse-parent relationships on a Tanzanian paediatric ward" pptx
báo cáo sinh học:" Conflicting priorities: evaluation of an intervention to improve nurse-parent relationships on a Tanzanian paediatric ward" pptx
... Change, on nurse-parent relationships on a paediatric ward in a busy regional hospital in Tanza-nia. The evaluation used before-and-after questionnaireswith parents/guardians and two after -intervention ... relationships on a Tanzanian paediatric wardRachel N Manongi1, Fortunata R Nasuwa2, Rose Mwangi2, Hugh Reyburn2,3, Anja Poulsen2,4 and Clare IR Chandler*3Address: 1Community Health Department, ... Kilimanjaro Christian Medical Centre, Moshi, Tanzania, 2Joint Malaria Programme, Kilimanjaro Christian Medical Centre, Moshi, Tanzania, 3Department of Infectious and Tropical Diseases, London...
- 14
- 976
- 0
Báo cáo sinh học: "Construction and characterization of an infectious clone of coxsackievirus A16" docx
... Xba I CV(1–4392) amplification P3 CTACGCTCTAGAAAGAAGGA Xba I CV(4381–7410) amplification P4 ACAAGCGGCCGCTGCTATTCTGGTTATAAC Not I CV(4381–7410) amplification P5 CTTCTCGAGGTTGATTTTGAGCAAGCATTG ... This clone will also allow the rapid, rational development and testing of candidate live attenuated vaccines and antiviral therapeutics against CVA16. Methods Cells and viruses RD and Vero ... lane 2, CV(4381–7410); and lane 3, CV(6087–7410-pA). (B) PCR amplification of the CVA16 full-length cDNA plus T7 promoter and 3′ poly (A) sequence. Lane Construction and characterization of an...
- 22
- 455
- 0
Báo cáo khoa học: The changing patterns of covalent active site occupancy during catalysis on a modular polyketide synthase multienzyme revealed by ion-trap mass spectrometry pptx
... may also influence thesteady-state level of acylation of AT1 and ACP1domains.Identification of rate-limiting steps, and a modelfor suppression of iteration and the maintenance of fidelity of ... (AT1)appears as two fragments corresponding to alternativesites of proteolysis; one fragment has a molecular mass of 32582 Da and the second has a molecular mass of 32739 Da. As expected, after ... level of load-ing of methylmalonate on both the chain-extensionAT and ACP domains was considerably less than100%. As the AT-catalyzed reaction is readily revers-ible, the extent of loading of...
- 13
- 426
- 0
Báo cáo khoa học: Alternative binding modes of an inhibitor to two different kinases doc
... electro-negative atoms such as oxygen, nitrogen and sulfur and thatthe contact distance can be smaller than the sum of van derWaals radii in the direction of the bond connecting the Catom and the halogen. ... complex, each bromine atom makesbetween four and seven van der Waals contacts and twobromine atoms also make polar contacts. One bromineatom, Br7, contacts the NE of Arg47 (distance 3.0 A ˚). A second ... CK2.TBB atomPolar contacts (<3.4 A ˚) Van der Waals contacts (<4.4 A ˚)pCDK2 contacts CK2 contacts pCDK2 contacts CK2 contactsResidue atom Distance (A ˚) Residue atom Distance (A ˚)...
- 8
- 390
- 0
báo cáo hóa học: "Single-trial classification of NIRS signals during emotional induction tasks: towards a corporeal machine interface" pptx
... results across participants ranked by classification accuracyFigure 6Response latency analysis results across participants ranked by classification accuracy. Response latency analysis results across ... Canada and 2Bloorview Kids Rehab, Toronto, ON, CanadaEmail: Kelly Tai - kelly.tai@utoronto.ca; Tom Chau* - tom.chau@utoronto.ca* Corresponding author AbstractBackground: Corporeal machine ... between a number of parameters, namely,feature subset and analysis interval length, and stimulusvalence and classification accuracy. Lastly, classificationaccuracy was used to quantify the latency...
- 14
- 320
- 0
Tài liệu Báo cáo khoa học " Towards Better Evaluation of Design Wind Speed of Vietnam " doc
... 051015202530 A4 A8 A1 2 A1 6 A2 0 A2 4 A2 8 A3 2 A3 6 A4 0 A4 4 A4 8 A5 2 A5 6 A6 0annual rate-TH1 annual rate-TH2 annual rate-TH3Annual rate StationAnnual rate= number of events/year(d) (c) 2030405060 A4 A8 A1 2 A1 6 A2 0 A2 4 A2 8 A3 2 A3 6 A4 0 A4 4 A4 8 A5 2 A5 6 A6 0TH1-R5TH1-R50TH2-R5TH2-R50TH3-R5TH3-R50Wind ... IS-R50050100150200 A2 1 A1 7 A2 2 A2 6 A2 7 A2 8 A2 9 A1 0 A3 3 A4 8 A4 9 A5 0 A5 1 A5 2 A5 3 A5 4 A5 5 A5 7 A2 3 A2 4 A2 5 A3 0 A3 1 A3 2 A3 4 A3 5 A3 6 A3 7 A3 8 A3 9 A4 0 A4 1 A4 2 A4 3 A4 4 A4 5 A4 6 A4 7 A5 6 A5 9 A6 0 A5 8Distance from coastline(km)StationStations located within 40 km of coastline ... direction) Stations far from coastline (in North-south direction) (a) 01234 A2 1 A1 7 A2 2 A2 6 A2 7 A2 8 A2 9 A1 0 A3 3 A4 8 A4 9 A5 0 A5 1 A5 2 A5 3 A5 4 A5 5 A5 7 A2 3 A2 4 A2 5 A3 0 A3 1 A3 2 A3 4 A3 5 A3 6 A3 7 A3 8 A3 9 A4 0 A4 1 A4 2 A4 3 A4 4 A4 5 A4 6 A4 7 A5 6 A5 9 A6 0 A5 8Rate-2000Rate-19994Rate-1990Annual...
- 12
- 574
- 0
Báo cáo khoa học: "Task-oriented Evaluation of Syntactic Parsers and Their Representations" potx
... T. Maxwell, and A. Vasserman. 2004. Speed and accuracy in shallowand deep stochastic parsing. In HLT/NAACL’04.S. Katrenko and P. Adriaans. 2006. Learning relationsfrom biomedical corpora using ... identification is a reasonable task forparser evaluation, because it is a typical informationextraction (IE) application, and because recent stud-ies have shown the effectiveness of syntactic parsingin ... this task. Since our evaluation method is applica-ble to any parser output, and is grounded in a realapplication, it allows for a fair comparison of syn-tactic parsers based on different frameworks.Parser...
- 9
- 483
- 0
Báo cáo khoa học: "Instance-based Evaluation of Entailment Rule Acquisition" pot
... bound evaluations. These Kappa scores areregarded as ‘substantial agreement’ and are substan-tially higher than published agreement scores andthose we managed to obtain using the standard rule-based ... representationmodel for automatic IE pattern acquisition. In Pro-ceedings of ACL.Idan Szpektor, Hristo Tanev, Ido Dagan, and Bonaven-tura Coppola. 2004. Scaling web-based acquisition of entailment ... 2007.c2007 Association for Computational LinguisticsInstance-based Evaluation of Entailment Rule AcquisitionIdan Szpektor, Eyal Shnarch, Ido DaganDept. of Computer ScienceBar Ilan UniversityRamat...
- 8
- 373
- 0
Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf
... nonterminal labels of the treebank grammar. For example, our grammar main- tains a fairly large number of semantic classes of singular nouns, and it is natural to stipulate that each of them is label-consistent ... (viz. a year) or else a number. Note that all of these classifications were made on the basis of the examination of concordances over a several-hundred- thousand-word sample of manuals data. ... range of sentence types and the availability of large corpora of computer manuals. We amassed a corpus of 40 million words, consisting of several hundred computer manuals. Our approach in attacking...
- 8
- 562
- 0
Báo cáo khoa học: "Contents and evaluation of the first Slovenian-German online dictionary" doc
... German-Slovenian onlinedictionary and contains evaluation fig-ures for its Slovenian part. Evaluationsare based on coverage of a Sloveniannewspaper corpus as well as on userqueries.1 IntroductionThe ... more than one equivalent in theother language, as many entries as necessary arecreated.3 Evaluation The evaluations of the Slovenian part of the dic-tionary concern its coverage of a) the ... contextualexamples of words and grammatical forms.Grammar information for both languages andinformation on stressed syllables for the Slovenianentries are contained in additional fields. For bothlanguages,...
- 4
- 321
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ