báo cáo sinh học:" Migration as a form of workforce attrition: a nine-country study of pharmacists" pptx
Tài liệu Báo cáo khoa học: "Lemmatisation as a Tagging Task" pdf
... Geneva tanja.samardzic@unige.ch Abstract We present a novel approach to the task of word lemmatisation. We formalise lemmati- sation as a category tagging task, by describ- ing how a word-to-lemma transformation ... Linguistics Lemmatisation as a Tagging Task Andrea Gesmundo Department of Computer Science University of Geneva andrea.gesmundo@unige.ch Tanja Samard ˇ zi ´ c De...
Ngày tải lên: 19/02/2014, 19:20
Tài liệu Báo cáo khoa học: "WSD as a Distributed Constraint Optimization Problem" pptx
... These approaches crucially rely on lexical knowledge base. Graph-based WSD approaches (Agirre and Soroa, 2009; Sinha and Mihalcea, 2007) per- form disambiguation over a graph composed of senses ... sense of a word as its vari- able. Each agent w i is associated with the variable s w i . The value assigned to this variable indicates the sense assigned by the algorithm. 3.3 Domains...
Ngày tải lên: 20/02/2014, 04:20
Báo cáo khoa học: Thermosynechoccus elongatus DpsA binds Zn(II) at a unique three histidine-containing ferroxidase center and utilizes O2 as iron oxidant with very high efficiency, unlike the typical Dps proteins ppt
... with protparam (http://www.expasy.org). Removal of the His-tag A factor Xa cleavage site was created between the last amino acid (valine) and the His-tag. Cleavage by factor Xa occurs after an arginine, ... Listeria innocua. Biochem J 338, 71–75. 32 Havukainen H, Haataja S, Kauko A, Pulliainen AT, Salminen A, Haikarainen T, Finne J & Papageorgiou AC (2008) Structural basis of the...
Ngày tải lên: 15/03/2014, 09:20
Báo cáo Y học: Mydj2 as a potent partner of hsc70 in mammalian cells doc
... pBL-SK plasmid at EcoRI s ite . In order to bacterially express Mydj2 the corresponding cDNAwasamplifiedbyPCRusingprimerI(5¢-GCA GTAGAGGATCCTGAAAGAAA-3¢) and primer II (5¢-GTTATTCAGTCGACCATTAAGAGG-3¢) ... conformation states [17]. Finally, overexpres- sion of dj2 was recently found to decrease aggregate formation caused by expanded polyglutamine tracts, a hallmark of neurodegenerative di...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo khoa học: "DATR AS A LEXICAL COMPONENT FOR PATR" pot
... the global environ- ment is changed in the course of the evaluation. As a declarative language, DATR is independent of the procedural evaluation strate- gies embodied in particular DATR-implementa- ... regularities using default inheritance, and exceptions, overriding. DATR axioms consist of node-path pairs associated with a right-hand side. This can be a value (atomic or...
Ngày tải lên: 18/03/2014, 02:20
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... [18]. GR assays indicated that human Hsp9 0a and Hsp90b, as well as the native yeast Hsp90s, were all capable of activating GR in these strains (Fig. 2). Active v-src expression is...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo y học: "Electronic patient record use during ward rounds: a qualitative study of interaction between medical staff"
... Funding was approved in spring 2006 for the purchase of a commercially available clinical information system (Metavi- sion; iMDsoft; Needham; Massachusetts; USA), which was deployed bed by bed across ... conversation rather than the data, as described above, and the use of paper to provide relevant data – are not surprising in that they address the issues of access to data and a n...
Ngày tải lên: 25/10/2012, 10:31
Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"
... Bedoya 1 , Juan Manuel Toro 5 , Jorge Byron Velásquez 4 , Juan Carlos Valencia 4 , Clara Maria Arango 5 , Pablo Henrique Aleman 1 , Esdras Martin Vasquez 4 , Juan Carlos Chavarriaga 4 , Andrés ... catheter-related infections and primary bacter- aemias); ICU length of stay; days of mechanical ventilation and incidence of severe hypoglycaemia defined as number of patients with at le...
Ngày tải lên: 25/10/2012, 10:35
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... consequences of variation and bias in relation to monitoring of animal disease incidence on herd and national level, causal analysis on national level, as well as estimation of validated treatment ... interviews [9]. 'Information redundancy' or 'data saturation' is a measure of the power and validity of the qualitative stud- ies [9]. Information redundancy...
Ngày tải lên: 25/10/2012, 10:45
Báo cáo y học: "Thioglycosides as inhibitors of hSGLT1 and hSGLT2: Potential therapeutic agents for the control of hyperglycemia in diabetes"
... D-glucose as a substrate of SGLT were performed and the corre- lation of sodium-dependent D-glucose uptake to sugar-induced cell membrane depolarization, as measured by FRET, was calculated. As shown ... Mizuma T, Hagi K, and Awazu S. Intestinal transport of beta-thioglycosides by Na+/glucose cotransporter. J Pharm Pharmacol. 2000; 52: 303-310. 28. Hirayama BA, Lostao MP, P...
Ngày tải lên: 26/10/2012, 10:04