báo cáo sinh học:" Appropriate training and retention of community doctors in rural areas: a case study from Mali" pdf

... implications As the training consists to a large extent in compensating for shortcomings of the medical school-based training, a reasonable approach would be to incorporate this kind of training in the basic ... of doctors into rural first line practice – unusual in Sub Saharan Africa – lie in Mali's health sector reform and health labour market evolution, as...

Ngày tải lên: 18/06/2014, 17:20

... not have any opinion. Regarding the quality of the training received, 52% felt it was adequate or very adequate, 20% that it was inade- quate or very inadequate and the remainder did not have any opinion. Expectations ... Access Research The training and expectations of medical students in Mozambique Fernando Sousa Jr* 1 , João Schwalbach 1 , Yussuf Adam 1 , Luzia Gonçalves 2...

Ngày tải lên: 18/06/2014, 17:20

... satisfaction and motivation of health workers in public and private sectors: cross-sectional analysis from two Indian states David H Peters 1* , Subrata Chakraborty 2 , Prasanta Mahapatra 3 , Laura Steinhardt 1 Abstract Background: ... different approach to arrive at random samples of health workers. In the case of AP, a database of public and private facilities was he...

Ngày tải lên: 18/06/2014, 17:20

Ngày tải lên: 18/06/2014, 18:20

... Medicine in Guinea-Bissau, is not currently integrated in any Univer- sity, and offers a training programme supported by Cuban tutors. It was, at the time of the study, in its third year of training. The ... 2008. Some of the questions w ere context-specific and adapted to the rea- lity of each country. All data were entered into an Access database and analysed usin...

Ngày tải lên: 18/06/2014, 17:20

... work in cardiovascular surgery. Possible impact of changes in initial clinical training system Japan introduced a new clinical training system in 2004, and this will probably affect physicians' ... physicians, the percentages of physicians working in rural areas and the average ages of physicians. The national population in these years was obtained by referrin...

Ngày tải lên: 18/06/2014, 17:20

... primers. ECD-forward: 5’ AAA CTC GAG ATG GAG CTG GCG GCC TTG T 3’ and reverse: 5’ CTT AAG CTT CGT CAG AGG GCT GGC TCT CT 3’ ;ICD-forward: 5’ AAACTCGAGAAGCGACGGCAGCAGAAG AT 3’ and reverse: 5’ CTT AAG CTT TCA ... Michael O Idowu 2 , Margaret M Grimes 2 , Laura Graham 3 , Maria-Libera Ascierto 4 , Ena Wang 4 , Xiang-Yang Wang 5 , Harry D Bear 3 and Masoud H Manjili 1* Abstract Background:...

Ngày tải lên: 18/06/2014, 19:20

... relating to low potency and cost. Peptide-based drug candidates are limited by insufficient efficacy and unfavorable phar- macokinetics. MAbs have increasingly gained favor in large part because ... HIV-1 OraSure Technologies, Inc. HIV/AIDS Market Cytolin CytoDyn Amerimmune Pharmaceuticals, Inc. HIV/AIDS I/II Tipranavir TIPRANAVIR HIV/AIDS III HXB AAI International, AnaaiPharma Company...

Ngày tải lên: 18/06/2014, 22:20

... African-Americans [6] and in African populations in Uganda, Zimbabwe, Tanzania, Central African Republic, South Africa and The Gambia [7-12]. In The Gambia, HSV-2 seropositivity among young adults from ... designed a rapid PCR-based assay to quantify and type HSV in cervicovaginal lavage (CVL) fluid of subjects attending a Genito-Urinary Medicine (GUM) clinic. Vaginal sw...

Ngày tải lên: 19/06/2014, 08:20

... prevalence of refractive errors. Quality Assurance All investigators and staff involved in this re- search participated in an intensive two-day training. Demographic data were collected by qualified ... demonstrated that age had a sig- nificant influence on the prevalence of hyperopia and myopia: as age increased, the prevalence of hyperopia markedly decreased, and th...

Ngày tải lên: 25/10/2012, 11:40