Báo cáo hóa học: " Translational Medicine is developing in China: A new venue for collaboration" ppt

... 9:3 http://www .translational- medicine. com/content/9/1/3 Page 4 of 4 Translational Medicine is developing in China: A new venue for collaboration Wang et al. Wang et al. Journal of Translational Medicine ... article as: Wang et al.: Translational Medicine is developing in China: A new venue for collaboration. Journal of Translational Medicine...

Ngày tải lên: 18/06/2014, 16:20

... data workup, statistical analysis and drafted the manuscript, VS was involved in technical assistance and in writing the manuscript, HD carried out H&E staining and CK19 IHC, CS coordinated ... ca use a major change during clinical practise. Therefore an interdisciplinary dialogue and plan- ning is indispensable for this procedure. Furthermore lymph node harvesting in fresh ti...

Ngày tải lên: 18/06/2014, 16:20

... Nussenblatt 1* , Francesco M Marincola 2 , Alan N Schechter 3 Abstract In recent years the concept of translational medicine has been advanced in an attempt to catalyze the medical applications ... studies. Nussenblatt et al. Journal of Translational Medicine 2010, 8:12 http://www .translational- medicine. com/content/8/1/12 Page 2 of 3 EDI T O R I A L Open Access Translational...

Ngày tải lên: 18/06/2014, 16:20

... polycistron as a potential human oncogene. Nature 2005, 435:828-833. 28. Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y, Takahashi T: A Polycistronic ... periph- eral blood may emerge as an important biomarker in patients with malignancy. Sasaki et al. Journal of Translational Medicine 2010, 8:17 http://www .translational- medici...

Ngày tải lên: 18/06/2014, 16:20

... Innovative ap- plications of artificial intelligence, AAAI’97/IAAI’97, pages 598–603. AAAI Press. Michael Collins and Terry Koo. 2005. Discrimina- tive reranking for natural language parsing. ... discriminative rerank- ing. In Proceedings of the 43rd Annual Meeting on Association for Computational Linguistics, ACL ’05, pages 173–180, Morristown, NJ, USA. Association for Computational L...

Ngày tải lên: 17/03/2014, 00:20

... that directly upstream of P HOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3¢ and 5¢ -ATCTTTCAAATAGAGCCTGG-3¢). The amplified DNA fragments were used to transform BFG2Z18-K3 5A, ... 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3 ¢. The final ratio of target cells was determined by the number of colonies retaining the target gene divided by...

Ngày tải lên: 22/03/2014, 21:20

... M, Chayahara N, Yamada T, Miki I, Okamura N, Kadowaki Y, Shirasaka D, Aoyama N, Nakamura T, Okumura K, Azuma T, Kasuga M, Sakaeda T. Favorable genetic polymorphisms predictive of clinical outcome ... Ehninger G, Stoehlmacher J. Phar- macogenetic analyses of a phase III trial in metastatic gastroesoph- ageal adenocarcinoma with fluorouracil and leucovorin plus either oxaliplatin or cis...

Ngày tải lên: 25/10/2012, 10:51

... human cancers, including prostate carcinoma, squamous cell lung carcinoma, lung adenocarcinoma, ovarian cystadenocarcinoma, colorectal carcinoma, renal cell carcinoma, osteosarcoma and hepatocellular ... represented samples from the following human tumor types that occur in a broad range of organs: prostate carcinoma, squamous cell lung carcinoma, lung adenocarcinoma, breast carcinoma, ga...

Ngày tải lên: 18/06/2014, 15:20

... Yamada T, Hirahashi M, Iida M, Tsuneyoshi M: Evaluation of risk of liver metastasis in colorectal adenocarcinoma based on the combination of risk factors including CD10 expression: multivariate ... 5-year survival rate was 69.4%. Based on univariate analysis, including all stage IIIB patients applicable to survival analyses (n = 98), age, gender, tumor invasive depth, pathologic grade, and...

Ngày tải lên: 18/06/2014, 16:20

... well-characterized histopathologic changes, from intestinal metaplasia, over low-grade and high-grade intraepithelial neoplasia towards invasive esophageal adenocarcinomas (EAC) [2,3]. However, not all EACs are associated with ... this article as: Grimm et al.: MMP-1 is a (pre-)invasive factor in Barrett-associated esophageal adenocarcinomas and is associated with positive lymph node...

Ngày tải lên: 18/06/2014, 16:20