Báo cáo hóa học: " Translational Medicine is developing in China: A new venue for collaboration" ppt

Báo cáo hóa học: " Translational Medicine is developing in China: A new venue for collaboration" ppt

Báo cáo hóa học: " Translational Medicine is developing in China: A new venue for collaboration" ppt

... 9:3 http://www .translational- medicine. com/content/9/1/3 Page 4 of 4 Translational Medicine is developing in China: A new venue for collaboration Wang et al. Wang et al. Journal of Translational Medicine ... article as: Wang et al.: Translational Medicine is developing in China: A new venue for collaboration. Journal of Translational Medicine...

Ngày tải lên: 18/06/2014, 16:20

5 312 0
Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx

Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx

... data workup, statistical analysis and drafted the manuscript, VS was involved in technical assistance and in writing the manuscript, HD carried out H&E staining and CK19 IHC, CS coordinated ... ca use a major change during clinical practise. Therefore an interdisciplinary dialogue and plan- ning is indispensable for this procedure. Furthermore lymph node harvesting in fresh ti...

Ngày tải lên: 18/06/2014, 16:20

6 535 0
Báo cáo hóa học: " Translational Medicine - doing it backwards" ppt

Báo cáo hóa học: " Translational Medicine - doing it backwards" ppt

... Nussenblatt 1* , Francesco M Marincola 2 , Alan N Schechter 3 Abstract In recent years the concept of translational medicine has been advanced in an attempt to catalyze the medical applications ... studies. Nussenblatt et al. Journal of Translational Medicine 2010, 8:12 http://www .translational- medicine. com/content/8/1/12 Page 2 of 3 EDI T O R I A L Open Access Translational...

Ngày tải lên: 18/06/2014, 16:20

3 366 0
Báo cáo hóa học: " miR-17-92 expression in differentiated T cells - implications for cancer immunotherapy" docx

Báo cáo hóa học: " miR-17-92 expression in differentiated T cells - implications for cancer immunotherapy" docx

... polycistron as a potential human oncogene. Nature 2005, 435:828-833. 28. Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y, Takahashi T: A Polycistronic ... periph- eral blood may emerge as an important biomarker in patients with malignancy. Sasaki et al. Journal of Translational Medicine 2010, 8:17 http://www .translational- medici...

Ngày tải lên: 18/06/2014, 16:20

12 381 0
Báo cáo khoa học: "Parsing the Internal Structure of Words: A New Paradigm for Chinese Word Segmentation" doc

Báo cáo khoa học: "Parsing the Internal Structure of Words: A New Paradigm for Chinese Word Segmentation" doc

... Innovative ap- plications of artificial intelligence, AAAI’97/IAAI’97, pages 598–603. AAAI Press. Michael Collins and Terry Koo. 2005. Discrimina- tive reranking for natural language parsing. ... discriminative rerank- ing. In Proceedings of the 43rd Annual Meeting on Association for Computational Linguistics, ACL ’05, pages 173–180, Morristown, NJ, USA. Association for Computational L...

Ngày tải lên: 17/03/2014, 00:20

10 476 0
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

... that directly upstream of P HOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3¢ and 5¢ -ATCTTTCAAATAGAGCCTGG-3¢). The amplified DNA fragments were used to transform BFG2Z18-K3 5A, ... 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3 ¢. The final ratio of target cells was determined by the number of colonies retaining the target gene divided by...

Ngày tải lên: 22/03/2014, 21:20

9 356 0
Báo cáo y học: "Translational Medicine and Reliability of Single-Nucleotide Polymorphism Studies: Can We Believe in SNP Reports or Not"

Báo cáo y học: "Translational Medicine and Reliability of Single-Nucleotide Polymorphism Studies: Can We Believe in SNP Reports or Not"

... M, Chayahara N, Yamada T, Miki I, Okamura N, Kadowaki Y, Shirasaka D, Aoyama N, Nakamura T, Okumura K, Azuma T, Kasuga M, Sakaeda T. Favorable genetic polymorphisms predictive of clinical outcome ... Ehninger G, Stoehlmacher J. Phar- macogenetic analyses of a phase III trial in metastatic gastroesoph- ageal adenocarcinoma with fluorouracil and leucovorin plus either oxaliplatin or cis...

Ngày tải lên: 25/10/2012, 10:51

9 524 0
báo cáo hóa học:" TRIP-Br2 promotes oncogenesis in nude mice and is frequently overexpressed in multiple human tumors" ppt

báo cáo hóa học:" TRIP-Br2 promotes oncogenesis in nude mice and is frequently overexpressed in multiple human tumors" ppt

... human cancers, including prostate carcinoma, squamous cell lung carcinoma, lung adenocarcinoma, ovarian cystadenocarcinoma, colorectal carcinoma, renal cell carcinoma, osteosarcoma and hepatocellular ... represented samples from the following human tumor types that occur in a broad range of organs: prostate carcinoma, squamous cell lung carcinoma, lung adenocarcinoma, breast carcinoma, ga...

Ngày tải lên: 18/06/2014, 15:20

15 430 0
Báo cáo hóa học: "The density of macrophages in the invasive front is inversely correlated to liver metastasis in colon cancer" docx

Báo cáo hóa học: "The density of macrophages in the invasive front is inversely correlated to liver metastasis in colon cancer" docx

... Yamada T, Hirahashi M, Iida M, Tsuneyoshi M: Evaluation of risk of liver metastasis in colorectal adenocarcinoma based on the combination of risk factors including CD10 expression: multivariate ... 5-year survival rate was 69.4%. Based on univariate analysis, including all stage IIIB patients applicable to survival analyses (n = 98), age, gender, tumor invasive depth, pathologic grade, and...

Ngày tải lên: 18/06/2014, 16:20

9 829 0
Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc

Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc

... well-characterized histopathologic changes, from intestinal metaplasia, over low-grade and high-grade intraepithelial neoplasia towards invasive esophageal adenocarcinomas (EAC) [2,3]. However, not all EACs are associated with ... this article as: Grimm et al.: MMP-1 is a (pre-)invasive factor in Barrett-associated esophageal adenocarcinomas and is associated with positive lymph node...

Ngày tải lên: 18/06/2014, 16:20

11 647 0
w