Báo cáo hóa học: " Expression of the RNA-binding protein RBM

Báo cáo hóa học: " Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer" ppt

... this article as: Ehlén et al.: Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer. Journal of Translational ... Access Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in ep...

Ngày tải lên : 18/06/2014, 16:20

12
531
0

Báo cáo Y học: Expression of the uncoupling protein 1 from the aP2 gene promoter stimulates mitochondrial biogenesis in unilocular adipocytes in vivo potx

... (5¢)3¢) Antisense primer (5¢)3¢) GenBank acc. no. COX IV a AGAAGGCGCTGAAGGAGAAGGA CCAGCATGCCGAGGGAGTGA NM_009941 NRF-1 ATGGGCCAATGTCCGCAGTGATGTC GGTGGCCTCTGATGCTTGCGTCGTCT AF098077 b-actin GAACCCTAAGGCCAACCGTGAAAAGAT ... explain the lack of the effect of the transgene on the size of the latter depot [16,17]; this is also associated with the differential effect of...

Ngày tải lên : 31/03/2014, 15:20

10
555
0

Báo cáo hóa học: " Incidence of the V600K mutation among melanoma patients with BRAF mutations, and potential therapeutic response to the specific BRAF inhibitor PLX4032" potx

... research; RH, in charge of analyzing tumor specimens and participated in writing the manuscript. All authors have read and approved the final manuscript. Competing interests The authors declare ... the BRAF mutation analysis; AB, collected tumor material and established melanoma cells in culture; HMK, participated in writing of the manuscript; DN, excised tumors a...

Ngày tải lên : 18/06/2014, 16:20

3
349
0

Báo cáo khoa học: Mutation of epidermal growth factor receptor is associated with MIG6 expression docx

... upstream signaling dynamics, which concomitantly regulate the dynamics of the original pathway. Kinases and effector proteins in the EGFR-mitogen-activated protein kinase (MAPK) cascade are particular ... the KEGG pathway database, PubMed abstracts and the Entrez Gene database, including Gene- RIF. ErbB and MAPK signaling pathway-related genes T. Nagashima et al. EGFR mu...

Ngày tải lên : 30/03/2014, 01:20

13
347
0

báo cáo hóa học: " Participation of MCP-induced protein 1 in lipopolysaccharide preconditioning-induced ischemic stroke tolerance by regulating the expression of proinflammatory cytokines" pdf

... becoming increasingly clear that inflammation and innate immune response play an important role in the brain injury after ischemic stroke [26, 27]. Inflammatory mechanisms that are activated within ... before MCAO. (A) Infarct images obtained by TTC staining at 48h after MCAO. The normal tissue was stained deep red and the infarct was stained milky. (B) Brain infarcts were a...

Ngày tải lên : 19/06/2014, 22:20

38
422
0

Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

... promoters indicate the a- F1-ATPase GAF/Adf-1 binding cassette has enhancer properties. (A) The basal promoter activity of b-F1-ATPase is greatly increased when the a- F1-ATPase GAF/Adf-1 binding cassette ... nucleosome structure a nd activate transcription both in vitro and in vivo [38]. To analyse the involvement of the potential GAF and Adf-1 binding sites in...

Ngày tải lên : 07/03/2014, 16:20

11
532
0

Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deﬁcient strain of Saccharomyces cerevisiae and study of its complementation pdf

... that the Vma3p was indispensable for the assembly of subunits A and B. Hirata et al. [19] investigated the functions of Vma11p and Vma16p in the S. cerevisiae V-ATPase complex, and reported that ... vector In the case of AACEVAPD1, 3 and 6, TAA is used as an Acetabularia-speciﬁc codon usage (translated as Gln). Conversion of TAA to CAA was performed by PCR as...

Ngày tải lên : 08/03/2014, 23:20

8
391
0

Báo cáo khoa học: Expression of the pyrG gene determines the pool sizes of CTP and dCTP in Lactococcus lactis doc

... concentrations and a negative control on the UTP concentration. Materials and methods Bacterial strains and plasmids The strains and plasmids used in this study are listed in Table 1. Plasmid pCJ31B contains ... contains the L. lactis pyrG gene, and was made from a PCR-product made with prim- ers pyrG1 1a (5¢-GTAGAAGCTAAAATCTGG-3¢ )and SLLH7 (5¢-TACAAAAGATTTTGGGC-3...

Ngày tải lên : 16/03/2014, 16:20

8
489
0

Báo cáo khoa học: Expression of the Pycnoporus cinnabarinus laccase gene in Aspergillus niger and characterization of the recombinant enzyme pdf

... raised against the P. cinnabarinus laccase. The Western blot analysis show ed a unique band corresponding to the 70-kDa protein demonstrating that this protein is the recombinant laccase. Northern ... mass of t he native laccase and and 10% for the recombinant l accase. I n the heterologous production of the P. cinnabarinus lac case in P. past oris [14] or the...

Ngày tải lên : 17/03/2014, 11:20

8
495
0

Báo cáo Y học: Expression of the aspartate/glutamate mitochondrial carriers aralar1 and citrin during development and in adult rat tissues docx

... We investigated the pattern of expression of aralar1 and citrin in murine embryonic and adult tissues at the mRNA and protein levels. Insituhybridization analysis indicates that both isoforms are ... citrin and aralar1 were performed in parallel and reincubated with anti-(b-F 1 ATPase). Aralar1 was detected with an antibody directed against its N-terminus, or aga...

Ngày tải lên : 24/03/2014, 04:21

8
432
0