Báo cáo hóa học: " Human cord blood progenitors with high aldehyde dehydrogenase activity improve vascular density in a model of acute myocardial infarction" ppt
... RESEARC H Open Access Human cord blood progenitors with high aldehyde dehydrogenase activity improve vascular density in a model of acute myocardial infarction Claus S Sondergaard 1,7 , David A ... dehydrogenase activity improve vascular density in a model of acute myocardial infarction. Journal of Translational Medicine 2010 8:24....
Ngày tải lên: 18/06/2014, 16:20
... AAGGGCACAGCATCTGTAGTCA AAGTCTTCAGCAGAGGGTCACGTA 104 59 PTCH CGCTGTCTTCCTTCTGAACC ATCAGCACTCCCAGCAGAGT 282 60 GLI1 CTCTGAGACGCCATGTTCAA ATCCGACAGAGGTGAGATGG 282 60 ε-globin CACTAGCCTGTGGAGCAAGATGAA AATCACCATCACGTTACCCAGGAG ... 59 T TGTCCCAGGTGGCTTACAGATGAA GGTGTGCCAAAGTTGCCAATACAC 144 59 FOXA2 CCATTGCTGTTGTTGCAGGGAAGT CACCGTGTCAAGATTGGGAATGCT 196 59 NeuroD CCCATGGTGGGTTGTCATATATTCATGT CCAGCATC...
Ngày tải lên: 18/06/2014, 15:20
... resuspended in PBS (Gibco – Invitrogen, Carlsbad, CA) at a concentration of 1.0 × 10 5 cells/mL and stained with saturating concentration of antibodies. After 45 minute incubation in the dark at room ... streptomycin (Invitrogen, Carlsbad, CA) in plastic flasks (25 cm 2 ), and maintained in a humidified atmosphere of 5% CO 2 in air at 37°C. The culture medium used for e...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Human T cells express CD25 and Foxp3 upon activation and exhibit effector/memory phenotypes without any regulatory/suppressor function" ppt
... 206D) according to the manufacturer's protocol. Apoptosis was determined by staining of cells with Annexin V (BD Pharmingen). Proliferation assay FITC BrdU Flow Kit (BD Pharmingen) was used in ... cells/ml in the same medium contain- ing 10% heat inactivated FBS. Allogeneic stimulating cells were irradiated in a cesium irradiator to a total dose of 5,000 rad, to abolish...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Human immunodeficiency virus and human papilloma virus - why HPV-induced lesions do not spontaneously resolve and why therapeutic vaccination can be successful" pot
... Nascimento MC, Madeleine MM, Franceschi S: Prevalence and type distribution of human papillomavirus in carcinoma and intraepithelial neoplasia of the vulva, vagina and anus: a meta-analysis. Int ... neoplasia (CIN), vulvar intraepithelial neoplasia (VIN) and anal intraepithelial neoplasia (AIN) as well as their subsequent progression to invasive squamous cell carcinoma [1-5]. While...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " Human saliva, plasma and breast milk exosomes contain RNA: uptake by macrophages" pdf
... RNA in plasma exosomes was characterised as mRNA. Our result extends the characterisation of exosomes in heal thy humans and confirms the presence of RNA in human saliva and plasma exosomes and ... RNA was detected with a Bioanalyzer and mRNA was identified by the synthesis of cDNA using an oligo (dT) primer and analysed with a Bioanalyzer. The uptake of PKH67-labelled...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học:" Randomized phase II study with two gemcitabine- and docetaxel-based combinations as first-line chemotherapy for metastatic non-small cell lung cancer" docx
... responsible for patient care and data acquisition. FZ was in charge of quality control and monitoring. MDA and ON were responsible for data management and statistical analyses. AP, GLF and DAM wrote ... (CR) was defined as the disappearance of all lesions and no appear- ance of new disease for at least 4 weeks. Partial response (PR) was defined as a reduction by at least 50% in th...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Aurora kinase inhibitors synergize with paclitaxel to induce apoptosis in ovarian cancer cells" pot
... Aurora -A staining of TMA core of ovarian carcinoma without adjuvant chemo- therapy (20×). (F) Aurora -A staining of TMA core of benign ovarian tissue (20×). (G) Aurora -A staining of TMA core of ... purposes) 56. Ohashi S, Sakashita G, Ban R, Nagasawa M, Matsuzaki H, Murata Y, Taniguchi H, Shima H, Furukawa K, Urano T: Phospho-regulation of human protein kinase Aurora -A:...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Retinal pigment epithelial cells secrete neurotrophic factors and synthesize dopamine: possible contribution to therapeutic effects of RPE cell transplantation in Parkinson''''s disease" doc
... volume. cDNA was used as template in the following PCR assay. The primers used for PCR assays were as follows: (1) DDC, forward: 5'-TTACTCATCCGATCAGGCACAC-3', reverse: 5'-GGCAGAACAGTCAAAATTCACC-3'; ... Shukla S, Agrawal AK, Chaturvedi RK, Seth K, Srivastava N, Sinha C, Shukla Y, Khanna VK, Seth PK: Co-transplantation of carotid body and ventral mesencephalic cells as a...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học: " Social and dental status along the life course and oral health impacts in adolescents: a population-based birth cohort" ppt
... the statistical analy- sis and interpretation of data, and drafted the manuscript. MAP participated in the collection, analysis and interpre- tation of data, and revising critically the manuscript. CLPA, ... cohort participant's life were associated with OIDP in adolescence. As higher untreated dental caries at age 6 and 12 years, and the presence of dental pain, gingival ble...
Ngày tải lên: 18/06/2014, 19:20