báo cáo hóa học:" Regulatory activity of azabisphosphonate-c

báo cáo hóa học:" Regulatory activity of azabisphosphonate-capped dendrimers on human CD4+ T cell proliferation enhances ex-vivo expansion of NK cells from PBMCs for immunotherapy" potx

... led to higher NK cell expansion yield providing support that T cells constitute a barrier for the expansion of NK cells. IL-2 stimulation of PBMCs was shown to elicit absolute expansion of NK cells ... that our protocol prevents the IL-2 related expansion of regulatory T cells that would be deleterious for the activity of infused NK cells. Co...

Ngày tải lên : 18/06/2014, 15:20

13
404
0

Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc

... gttcttctatgtggccctttgtct tcttgggctctgggtgattc TCRVB12s1, 12s3 VB13A L36092 tggtgctggtatcactgaccaa ggaaatcctctgtggttgatctg TCRVB13s1, 13s6 VB13B X61445 tgtgggcaggtccagtga tgtcttcaggacccggaatt TCRVB13s2, ... gagtctcatgctgatggcaact tctcgacgccttgctcgtat TCRVB2s1 VB3 U08314 tcctctgtcgtgtggccttt tctcgagctctgggttactttca TCRVB3s1 VB4 L36092 ggctctgaggccacatatgag ttaggtttgggcggctgat TCRVB4s1 VB5 L3609...

Ngày tải lên : 18/06/2014, 16:20

9
568
0

Báo cáo hóa học: "Regulatory T cell frequency in patients with melanoma with different disease stage and course, and modulating effects of high-dose interferon-a 2b treatment" pptx

... better understanding of the mechan- ism of act ion of IFN-a 2b may facilitate the development of treatment strategies to increase efficacy and reduce toxicity, ultimately leading to a better stan- dard ... distribution in the 20 healthy donors and by stage in the 44 patients with melanoma (22 patients treated in this study and the other 22 patients who were referred to our institution...

Ngày tải lên : 18/06/2014, 16:20

13
642
0

Báo cáo hóa học: "High activity of sequential low dose chemo-modulating Temozolomide in combination with Fotemustine in metastatic melanoma. A feasibility study" pptx

... patients had M1b staging, and 8 patients had M1c staging. Two patie nts had only 1 metastatic site; 7 patients had 2 metastatic sites; 5 patients had 3 or more metastatic sites. Treatment Two ... dramatic response in all metastatic sites (Figure 2). At present, after 13 months from starting therapy, this patientisaliveinPR.Thebiopsyofasubcutaneous lesion performed after the third cycle of...

Ngày tải lên : 18/06/2014, 16:20

8
459
0

báo cáo hóa học: " Physical activity and quality of life in community dwelling older adults" pptx

... However, it has been demonstrated that the effects of physical activity interventions on global self-esteem have tended to be rather small [41]. This contrasts with physical activity effects on domain ... of efficacy information from physical activity participation and interventions. This would sug- gest that such interventions can be effectively structured to maximize physica...

Ngày tải lên : 18/06/2014, 19:20

7
411
0

báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

... whether this hypothesized mediating effect of physical activity is consistent with respect to different chronic conditions. This information is vital to understanding the role of physical activity ... measure- ment of these health outcomes. This instrument consists of 31 questions pertaining to eight health attributes that represent limitations associated with hearing, vision, spe...

Ngày tải lên : 18/06/2014, 22:20

11
619
0

Báo cáo khoa học: Transcriptional activity and Sp 1⁄3 transcription factor binding to the P1 promoter sequences of the human AbH-J-J locus docx

... MEF-2. From the practical point of view, the impact of Sp proteins on the transcriptional regulation of this locus will be of future interest, considering the potential con- tribution of AAH ... here on the functional characterization of the P1 promoter of the AbH-J-J locus demonstrate that this belongs to the class of Sp1-controlled promoters, and it is different from...

Ngày tải lên : 23/03/2014, 07:20

15
362
0

Báo cáo hóa học: " Updated survivals and prognostic factor analysis in myeloma treated by a staged approach use of bortezomib/thalidomide/dexamethasone in transplant eligible patients" pot

... with subsequent need of VTD salvage upon completion of three cycles of VAD by Chi-Square test. Methylation study Methylation-specific polymerase chain reaction (MSP) for aberrant promoter methylation was ... DAPK methylation. However, the pro- portion of patients carrying DAPK methylation or devel- oping oligoclonal reconstitution was not different. On the other hand, more chemose...

Ngày tải lên : 18/06/2014, 16:20

7
489
0

Báo cáo hóa học: " The transfer from survey (map-like) to route representations into Virtual Reality Mazes: effect of age and cerebral lesion" doc

... contributions LC and MLR conceived the study rationale and design, participated to the study coordination, performed the statistical analysis and contributed to draft the manuscript. FM and CSt contributed ... to take the correct direction toward the exit point. A greater cognitive load, in particular spatial rotation skills, is required in order to do not get lost at the first steps. Spatial...

Ngày tải lên : 19/06/2014, 08:20

10
635
0

Báo cáo hóa học: " Robot-aided therapy for upper limbs in patients with stroke-related lesions. Brief report of a clinical experience" ppt

... with the treatment. Subjects underwent an assessment prior to the start of the rehabilitation project (T- 1), one at the start (T0 ), one at the end of the treatment (T1 ) and one after one month ... for the treatment satisfaction were administered to the subjects. Non-statistical difference of scores at T- 1 and T0 on almost the entire battery of tasks suggested a stable patien...

Ngày tải lên : 19/06/2014, 08:20

6
612
0