báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx

báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx

báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx

... purposes) Journal of Translational Medicine Open Access Research Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures Tatiana Jazedje 1 , Paulo ... the mesenchymal nature of human fallopian tube stem cells. These important features imply that htMSCs represent a cell population that can be r...

Ngày tải lên: 18/06/2014, 15:20

10 456 0
Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx

Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx

... m M 3-amino-1,2,4-triazole and in the absence of the amino acids leucine, tryptophan and histidine. Full-length human TESK1 cDNA in pAct2, in frame with the GAL4 activation domain and the HA-tag, ... Drosophila equivalent of the human adaptor protein Grb2) and the GTPase-activating protein GAP1 [2], or downstream of ras at the level of Raf/ MAP kinase [3]. Human sprouty fa...

Ngày tải lên: 31/03/2014, 15:20

11 542 0
Báo cáo Y học: Endogenous cardiac glycosides, a new class of steroid hormones pot

Báo cáo Y học: Endogenous cardiac glycosides, a new class of steroid hormones pot

... expression and activity of the ACE in hypothalamus and pons of Dahl salt-sensitive rats without a parallel increase in angioten- sin II levels. Chronic blockade of brain ÔouabainÕ by intraventricular infusion ... infusion of a ouabain-binding antibody lowered the NaCl-dependent rise in the amount of ACE mRNA, which may indicate that the increase in ACE mRNA is secondary...

Ngày tải lên: 24/03/2014, 00:21

9 651 0
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

... 3374–3378. 101 Kanaan A, Farahani R, Douglas RM, Lamanna JC & Haddad GG (2006) Effect of chronic continuous or intermittent hypoxia and reoxygenation on cerebral capillary density and myelination. Am J ... enzymes that lead to extracellular matrix degra- dation (matrix metalloproteases) [75–78]. In addition, NF-jB activation was reported as an early event in malignant transformatio...

Ngày tải lên: 30/03/2014, 04:20

12 390 0
Báo cáo hóa học: " Human cord blood progenitors with high aldehyde dehydrogenase activity improve vascular density in a model of acute myocardial infarction" ppt

Báo cáo hóa học: " Human cord blood progenitors with high aldehyde dehydrogenase activity improve vascular density in a model of acute myocardial infarction" ppt

... in 10 of 11 ALDH hi Lin - transplanted animals (Figure 2) and in four of six ALDH lo Lin - transplanted animals (data not shown). The human engraftment in the ALDH hi Lin - transplanted animals ... section analyzed, we found 1 to 10 human cells in the hearts of ALDH hi Lin - cell-transplanted ani- mals. The human cells were primarily found as individual cells located...

Ngày tải lên: 18/06/2014, 16:20

13 506 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

... 62:101-107. 36. Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association between the interleukin-2 receptor-alpha gene and ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent cha...

Ngày tải lên: 18/06/2014, 16:20

12 574 0
Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf

Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf

... histologi- cal sections. The antibody was tested on formalin-fixed paraffin-embedded normal human skin sections as well as on invasive-lobular mamma carcinoma and small cell bronchial carcinoma sections ... than PCNA- or Ki-67-positive cells. Cdc45 immunoreactivi- ty was mostly nuclear although a weak cytoplasmic staining was also seen (Fig. 9A) . In a series of inva- sive-lobular ma...

Ngày tải lên: 19/02/2014, 00:20

16 505 0
báo cáo hóa học:" The cancer secretome: a reservoir of biomarkers" doc

báo cáo hóa học:" The cancer secretome: a reservoir of biomarkers" doc

... M, Watanabe J, Takahashi T, Nishizawa K, Nishiyama H, Kamoto T, Mikami Y, Tanaka Y, et al.: Secreted CXCL1 Is a Potential Mediator and Marker of the Tumor Invasion of Bladder Cancer. Clin Cancer ... spec- tral profiles are captured by an analyzer. By analyzing these spectral profiles, a cancer-specific finger-print can be obtained. SELDI-TOF-MS has several advantages, includ- ing rel...

Ngày tải lên: 18/06/2014, 15:20

12 712 0
báo cáo hóa học:" Human embryonic stem cells hemangioblast express HLA-antigens" pot

báo cáo hóa học:" Human embryonic stem cells hemangioblast express HLA-antigens" pot

... ATTTGTGGAGGGCGAGGTCATAGA 159 59 SCL AAGGGCACAGCATCTGTAGTCA AAGTCTTCAGCAGAGGGTCACGTA 104 59 PTCH CGCTGTCTTCCTTCTGAACC ATCAGCACTCCCAGCAGAGT 282 60 GLI1 CTCTGAGACGCCATGTTCAA ATCCGACAGAGGTGAGATGG 282 60 ε-globin CACTAGCCTGTGGAGCAAGATGAA ... GGTCTCAAGTCAGTGTACAGGTAAGC 129 59 T TGTCCCAGGTGGCTTACAGATGAA GGTGTGCCAAAGTTGCCAATACAC 144 59 FOXA2 CCATTGCTGTTGTTGCAGGGAAGT CACCGTGTCAAGATTGGGAATGCT 196 59 Ne...

Ngày tải lên: 18/06/2014, 15:20

10 409 0
báo cáo hóa học:" Human T cells express CD25 and Foxp3 upon activation and exhibit effector/memory phenotypes without any regulatory/suppressor function" ppt

báo cáo hóa học:" Human T cells express CD25 and Foxp3 upon activation and exhibit effector/memory phenotypes without any regulatory/suppressor function" ppt

... Foxp3 intracellular staining was done with PE anti -human Foxp3 Flow Kit (Biolegend, clone 206D) according to the manufacturer's protocol. Apoptosis was determined by staining of cells with Annexin ... 16 h. B/I activation mimic intracellular signals that result in T cell activation by increasing protein kinase C activity and intracellular calcium, respectively [18-20]. Cells we...

Ngày tải lên: 18/06/2014, 15:20

7 404 0
w