báo cáo hóa học:" Static platelet adhesion, flow cytometry and serum TXB2 levels for monitoring platelet inhibiting treatment with ASA and clopidogrel in coronary artery disease: a randomised cross-over study" potx

... purposes) Journal of Translational Medicine Open Access Research Static platelet adhesion, flow cytometry and serum TXB 2 levels for monitoring platelet inhibiting treatment with ASA and clopidogrel in coronary ... (r 2 = 0.49). Data included are from all three separate anti -platelet treatments (ASA and clopidogrel alone as well as ASA and c...

Ngày tải lên: 18/06/2014, 15:20

... foundation in which to base the validation of a flow cytometry pharmacodynamic assay and applying the "appropriate" parameters for a cell based cytometry assay, we validated a MCP-1 internalization ... less than 10% across all individuals and all days (Table 5). In- study results This assay was used as a pharmacodynamic marker for biological activity of a...

Ngày tải lên: 18/06/2014, 15:20

... induce a facilitation of walking in PD subjects, due to the bypass of the affected neural pathways, i.e. the basal ganglia. In fact, it has been shown that basal ganglia play a primary role in ... regulation in Par- kinson's disease: the use of extrinsic, visual cues. Brain 2000, 123:2077-2090. 6. Martin JP: Locomotion and the basal ganglia. In The basal ganglia and p...

Ngày tải lên: 19/06/2014, 10:20

... Pharmingen) and anti-VE-Cadherin-PE (eBio- science), or Annexin-FITC and 7-Amino Actinomycin D (7-AAD BD Pharmingen) and analyzed by FACS. Once again to assess cellular viability an aliquot of ... (Invitrogen Carlsbad, CA) and quantitative PCR was performed using 2 ng of total cDNA and SYBRgreen (Applied Biosystem; CD52, 5'primer CTTCCTCCTACTCACCATCAGC, 3'primer CCACGAAGAA...

Ngày tải lên: 18/06/2014, 15:20

... ELISA and technical editing of the manuscript. TAR, JM and MTL participated in the design of experiments and interpretation of data. EW and FMM performed the miR microarray and assisted with analysis. ... primary authors, was one of the two primary writers of the paper, and heavily participated in experimental design and data analysis. All authors read and approved the f...

Ngày tải lên: 18/06/2014, 16:20

... primer (5'-AGGCCTGCTGAA AATGACT- GAATA-3'), 10 pmol K-ras antisense primer (5'-CTG- TATCAAAGAATGGTCCTGCAC-3'), and 1 U of Taq polymerase (Resnova). An additional no-template control containing ... RM: FISH analysis. IS: statistical analysis. EM: DNA extraction and k-ras mutation analysis. SC: DNA extraction and k-ras mutation analysis. MGD: patho- logical sample eval...

Ngày tải lên: 18/06/2014, 16:20

... uptake and localization of phthalocyanine and drafting of the manuscript. VJ con- ceived the study and participated in its design and coordi- nation and helped in interpretation of data and drafting the ... cellular transport and intracellular localization, (b) complex interactions between photobleaching and singlet oxygen quenching at high intracellular densities of AlPcS...

Ngày tải lên: 18/06/2014, 16:20

... mandatory, in the OSNA assay amplification directly starts from the lysate and therefore allows analysis of 3-4 LN within 30-40 minutes and 12 LN within 2 hours. For the reason that increasing ... data workup, statistical analysis and drafted the manuscript, VS was involved in technical assistance and in writing the manuscript, HD carried out H&E staining and CK19 IHC, C...

Ngày tải lên: 18/06/2014, 16:20

... was amplified by two rounds of PCR using semi-nested primers. The primer set BG1 (TATGGTGGGAGAAGAAATTAGTAAAGG) and BG2 (AATAACCTTATCCTCCTCTATAAAATAACC) were used in the first round and BG2 and ... ical agents that can elevate fetal hemo- globin have great potential as therapeutic agents. The DNA methyltransferase (DNMT) inhibitors 5-azacytidine and 5-aza-2’deoxycyidine (decitabine)...

Ngày tải lên: 18/06/2014, 16:20

... Translational Medicine and integrated the information about Chinese data with the broader scope of the Journal of Translational Medicine. All authors read and approved the final manuscript. Wang ... American and Chinese entities [12]. Several Universities are also becoming increasingly interested in supporting Translational efforts and several collab orate with the local govern-...

Ngày tải lên: 18/06/2014, 16:20